Regulon of ModE2 in Comamonas testosteroni KF-1

Properties
Regulator type:	Transcription factor
TF locus tag:	CtesDRAFT_0896
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 5.9 Sequence: AGTGTTATATTCCGTCAAATATAACGTG Locus tag: CtesDRAFT_0892 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: CtesDRAFT_0893 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	CtesDRAFT_0892	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	CtesDRAFT_0893	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Position: -50 Score: 5.9 Sequence: CACGTTATATTTGACGGAATATAACACT Locus tag: CtesDRAFT_0891 Name: COG1720 Funciton: Conserved hypothetical protein
	CtesDRAFT_0891	COG1720	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD