Regulon of ModE2 in Variovorax paradoxus S110

Properties
Regulator type:	Transcription factor
TF locus tag:	Vapar_4071
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -14 Score: 5.5 Sequence: TGCGTTGTATCTTCATGAATACGACGAA Locus tag: Vapar_4070 Name: modB Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Vapar_4069 Name: modA Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) Locus tag: Vapar_4068 Name: modC Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Vapar_4070	modB	Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
	Vapar_4069	modA	Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
	Vapar_4068	modC	Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD