Regulog ModE2 - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | |
| Biological process: | Molybdopterin biosynthesis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Burkholderia
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdopterin biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia cepacia AMMD | ||
| Burkholderia glumae BGR1 | 5 | 2 |
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia phymatum STM815 | ||
| Burkholderia pseudomallei K96243 | ||
| Burkholderia sp. 383 | 4 | 2 |
| Burkholderia vietnamiensis G4 | 8 | 4 |
| Burkholderia xenovorans LB400 | 4 | 2 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| mopI |
Gene: Bamb_6011: Molybdopterin-binding protein |
*
Burkholderia glumae BGR1 Site: position = -140 score = 6.2212 sequence = CGTTGTAAAGGTCGGTATATTACG Gene: bglu_2g05490: Molybdopterin-binding protein |
|
Gene: Bphy_5363: Molybdopterin-binding protein |
|
*
Burkholderia sp. 383 Site: position = -180 score = 5.8953 sequence = CGTTATCACCTTCAGTACATAACG Gene: Bcep18194_C7726: Molybdopterin-binding protein |
Gene: Bcep1808_5471: Molybdopterin-binding protein |
|
Molybdopterin-binding protein |
| Bxe_B1193 |
|
Gene: bglu_2g05500: Conserved hypothetical protein |
|
|
|
*
Burkholderia sp. 383 Site: position = -62 score = 5.65527 sequence = CGTAATATACCCGTCGATACAACG Gene: Bcep18194_B2795: Conserved hypothetical protein |
|
*
Burkholderia xenovorans LB400 Site: position = -67 score = 6.10338 sequence = CGTAATATACACACGGACATAACG Gene: Bxe_B1192: Conserved hypothetical protein |
Conserved hypothetical protein |
| modE2 |
|
Gene: bglu_2g05510: Molybdate-responsive transcriptional regulator ModE2, ModE family |
|
|
|
Gene: Bcep18194_B2794: Molybdate-responsive transcriptional regulator ModE2, ModE family |
Gene: Bcep1808_7293: Molybdate-responsive transcriptional regulator ModE2, ModE family |
Gene: Bxe_B1193: Molybdate-responsive transcriptional regulator ModE2, ModE family |
Molybdate-responsive transcriptional regulator ModE2, ModE family |
| nifQ |
|
|
|
|
|
Gene: Bcep18194_C7727: Nitrogenase FeMo-cofactor synthesis molybdenum delivery protein NifQ |
|
|
Nitrogenase FeMo-cofactor synthesis molybdenum delivery protein NifQ |
| CRON 2. | |||||||||
| modA2 |
|
*
Burkholderia glumae BGR1 Site: position = -38 score = 6.2212 sequence = CGTAATATACCGACCTTTACAACG Gene: bglu_2g05480: Molybdate ABC transporter, substrate-binding protein |
|
Gene: Bphy_5150: Molybdate ABC transporter, substrate-binding protein |
|
|
*4
Burkholderia vietnamiensis G4 Site: position = -41 score = 6.54952 sequence = CGTAATATACGTAACTTCATAACG Gene: Bcep1808_6097: Molybdate ABC transporter, substrate-binding protein Site: position = -41 score = 6.54952 sequence = CGTAATATACGTAACTTCATAACG Gene: Bcep1808_6644: Molybdate ABC transporter, substrate-binding protein Site: position = -41 score = 6.54952 sequence = CGTAATATACGTAACTTCATAACG Gene: Bcep1808_1646: Molybdate ABC transporter, substrate-binding protein Site: position = -41 score = 6.54952 sequence = CGTAATATACGTAACTTCATAACG Gene: Bcep1808_7470: Molybdate ABC transporter, substrate-binding protein |
*
Burkholderia xenovorans LB400 Site: position = -40 score = 5.87824 sequence = CGTAATATAGCGCTCTTAATAACG Gene: Bxe_B1190: Molybdate ABC transporter, substrate-binding protein |
Molybdate ABC transporter, substrate-binding protein |
| modCB2 |
Gene: Bamb_3863: Molybdate ABC transporter, ATP-binding/permease fused protein |
Gene: bglu_2g05470: Molybdate ABC transporter, ATP-binding/permease fused protein |
Gene: BMAA1688: Molybdate ABC transporter, ATP-binding/permease fused protein |
Gene: Bphy_5151: Molybdate ABC transporter, ATP-binding/permease fused protein |
Gene: BPSS1671: Molybdate ABC transporter, ATP-binding/permease fused protein |
|
4
Burkholderia vietnamiensis G4 Gene: Bcep1808_6645: Molybdate ABC transporter, ATP-binding/permease fused protein Gene: Bcep1808_1645: Molybdate ABC transporter, ATP-binding/permease fused protein Gene: Bcep1808_7469: Molybdate ABC transporter, ATP-binding/permease fused protein Gene: Bcep1808_6096: Molybdate ABC transporter, ATP-binding/permease fused protein |
Gene: Bxe_B1189: Molybdate ABC transporter, ATP-binding/permease fused protein |
Molybdate ABC transporter, ATP-binding/permease fused protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |