Regulon of ModE2 in Burkholderia sp. 383

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep18194_B2794
Regulator family:	ModE
Regulation mode:
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Burkholderia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Burkholderia
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -180 Score: 5.9 Sequence: CGTTATCACCTTCAGTACATAACG Locus tag: Bcep18194_C7726 Name: mopI Funciton: Molybdopterin-binding protein Locus tag: Bcep18194_C7727 Name: nifQ Funciton: Nitrogenase FeMo-cofactor synthesis molybdenum delivery protein NifQ
	Bcep18194_C7726	mopI	Molybdopterin-binding protein
	Bcep18194_C7727	nifQ	Nitrogenase FeMo-cofactor synthesis molybdenum delivery protein NifQ
Position: -62 Score: 5.7 Sequence: CGTAATATACCCGTCGATACAACG Locus tag: Bcep18194_B2795 Name: Bxe_B1193 Funciton: Conserved hypothetical protein Locus tag: Bcep18194_B2794 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
	Bcep18194_B2795	Bxe_B1193	Conserved hypothetical protein
	Bcep18194_B2794	modE2	Molybdate-responsive transcriptional regulator ModE2, ModE family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD