Orthologous regulated operons containing modCB2 gene

Properties
Regulog:	ModE2 - Burkholderia
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Phylum:	Proteobacteria/Beta

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Burkholderia glumae BGR1
Position: -38 Score: 6.2212 Sequence: CGTAATATACCGACCTTTACAACG Locus tag: bglu_2g05480 Name: modA2 Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: bglu_2g05470 Name: modCB2 Funciton: Molybdate ABC transporter, ATP-binding/permease fused protein
modA2-modCB2	-38	6.2	CGTAATATACCGACCTTTACAACG	bglu_2g05480
Burkholderia vietnamiensis G4
Position: -41 Score: 6.54952 Sequence: CGTAATATACGTAACTTCATAACG Locus tag: Bcep1808_1646 Name: modA2 Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bcep1808_1645 Name: modCB2 Funciton: Molybdate ABC transporter, ATP-binding/permease fused protein
modA2-modCB2	-41	6.5	CGTAATATACGTAACTTCATAACG	Bcep1808_1646
Burkholderia xenovorans LB400
Position: -40 Score: 5.87824 Sequence: CGTAATATAGCGCTCTTAATAACG Locus tag: Bxe_B1190 Name: modA2 Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bxe_B1189 Name: modCB2 Funciton: Molybdate ABC transporter, ATP-binding/permease fused protein
modA2-modCB2	-40	5.9	CGTAATATAGCGCTCTTAATAACG	Bxe_B1190

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --