Regulon of ModE2 in Burkholderia vietnamiensis G4

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep1808_7293
Regulator family:	ModE
Regulation mode:
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Burkholderia
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Burkholderia
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 6.5 Sequence: CGTAATATACGTAACTTCATAACG Locus tag: Bcep1808_7470 Name: modA2 Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bcep1808_7469 Name: modCB2 Funciton: Molybdate ABC transporter, ATP-binding/permease fused protein
	Bcep1808_7470	modA2	Molybdate ABC transporter, substrate-binding protein
	Bcep1808_7469	modCB2	Molybdate ABC transporter, ATP-binding/permease fused protein
Position: -41 Score: 6.5 Sequence: CGTAATATACGTAACTTCATAACG Locus tag: Bcep1808_6097 Name: modA2 Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bcep1808_6096 Name: modCB2 Funciton: Molybdate ABC transporter, ATP-binding/permease fused protein
	Bcep1808_6097	modA2	Molybdate ABC transporter, substrate-binding protein
	Bcep1808_6096	modCB2	Molybdate ABC transporter, ATP-binding/permease fused protein
Position: -41 Score: 6.5 Sequence: CGTAATATACGTAACTTCATAACG Locus tag: Bcep1808_1646 Name: modA2 Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bcep1808_1645 Name: modCB2 Funciton: Molybdate ABC transporter, ATP-binding/permease fused protein
	Bcep1808_1646	modA2	Molybdate ABC transporter, substrate-binding protein
	Bcep1808_1645	modCB2	Molybdate ABC transporter, ATP-binding/permease fused protein
Position: -41 Score: 6.5 Sequence: CGTAATATACGTAACTTCATAACG Locus tag: Bcep1808_6644 Name: modA2 Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: Bcep1808_6645 Name: modCB2 Funciton: Molybdate ABC transporter, ATP-binding/permease fused protein
	Bcep1808_6644	modA2	Molybdate ABC transporter, substrate-binding protein
	Bcep1808_6645	modCB2	Molybdate ABC transporter, ATP-binding/permease fused protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD