Regulon of ModE2 in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_2g05510
Regulator family:	ModE
Regulation mode:
Biological process:	Molybdopterin biosynthesis
Effector:	Molybdate
Regulog:	ModE2 - Burkholderia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Burkholderia
By TF family - ModE
By effector - Molybdate
By pathway - Molybdopterin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 6.2 Sequence: CGTTGTAAAGGTCGGTATATTACG Locus tag: bglu_2g05490 Name: mopI Funciton: Molybdopterin-binding protein Locus tag: bglu_2g05500 Name: Bxe_B1193 Funciton: Conserved hypothetical protein Locus tag: bglu_2g05510 Name: modE2 Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
	bglu_2g05490	mopI	Molybdopterin-binding protein
	bglu_2g05500	Bxe_B1193	Conserved hypothetical protein
	bglu_2g05510	modE2	Molybdate-responsive transcriptional regulator ModE2, ModE family
Position: -38 Score: 6.2 Sequence: CGTAATATACCGACCTTTACAACG Locus tag: bglu_2g05480 Name: modA2 Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: bglu_2g05470 Name: modCB2 Funciton: Molybdate ABC transporter, ATP-binding/permease fused protein
	bglu_2g05480	modA2	Molybdate ABC transporter, substrate-binding protein
	bglu_2g05470	modCB2	Molybdate ABC transporter, ATP-binding/permease fused protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD