Regulog ModE3 - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Tungsten homeostasis |
| Effector: | Tungsten |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - ModE
- By taxonomy - Comamonadaceae
- By TF family - ModE
- By effector - Tungsten
- By pathway - Tungsten homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||
| Acidovorax sp. JS42 | 8 | 2 |
| Comamonas testosteroni KF-1 | ||
| Delftia acidovorans SPH-1 | ||
| Leptothrix cholodnii SP-6 | 12 | 2 |
| Methylibium petroleiphilum PM1 | 4 | 1 |
| Polaromonas naphthalenivorans CJ2 | 8 | 2 |
| Polaromonas sp. JS666 | 10 | 2 |
| Rhodoferax ferrireducens DSM 15236 | 10 | 2 |
| Variovorax paradoxus S110 | 3 | 1 |
| Verminephrobacter eiseniae EF01-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| Ajs_3943 |
|
*
Acidovorax sp. JS42 Site: position = -65 score = 6.44664 sequence = CTATGCAAATCTTTTCATAG Gene: Ajs_3943: NADH-dependent dehydrogenase, iron-sulfur binding protein |
|
|
*
Leptothrix cholodnii SP-6 Site: position = -91 score = 6.17166 sequence = CTATGCAGATGATTGCATAG Gene: Lcho_1816: NADH-dependent dehydrogenase, iron-sulfur binding protein |
Gene: Mpe_A2582: NADH-dependent dehydrogenase, iron-sulfur binding protein |
*
Polaromonas naphthalenivorans CJ2 Site: position = -60 score = 5.94604 sequence = CTATGCAAATCAATTCATAG Gene: Pnap_0048: NADH-dependent dehydrogenase, iron-sulfur binding protein |
|
Gene: Rfer_2851: NADH-dependent dehydrogenase, iron-sulfur binding protein |
|
|
NADH-dependent dehydrogenase, iron-sulfur binding protein |
| Ajs_3944 |
|
Gene: Ajs_3944: Tungsten-containing aldehyde ferredoxin oxidoreductase |
|
|
Gene: Lcho_1817: Tungsten-containing aldehyde ferredoxin oxidoreductase |
Gene: Mpe_A2581: Tungsten-containing aldehyde ferredoxin oxidoreductase |
Gene: Pnap_0049: Tungsten-containing aldehyde ferredoxin oxidoreductase |
|
Gene: Rfer_2850: Tungsten-containing aldehyde ferredoxin oxidoreductase |
|
|
Tungsten-containing aldehyde ferredoxin oxidoreductase |
| Ajs_3945 |
|
Gene: Ajs_3945: NADH-dependent dehydrogenase, NADH-binding subunit |
|
|
Gene: Lcho_1818: NADH-dependent dehydrogenase, NADH-binding subunit |
Gene: Mpe_A2580: NADH-dependent dehydrogenase, NADH-binding subunit |
Gene: Pnap_0050: NADH-dependent dehydrogenase, NADH-binding subunit |
|
Gene: Rfer_2849: NADH-dependent dehydrogenase, NADH-binding subunit |
|
|
NADH-dependent dehydrogenase, NADH-binding subunit |
| Ajs_3946 |
|
Gene: Ajs_3946: Conserved hypothetical protein |
|
|
Gene: Lcho_1819: Conserved hypothetical protein |
Gene: Mpe_A2579: Conserved hypothetical protein |
Gene: Pnap_0051: Conserved hypothetical protein |
|
Gene: Rfer_2848: Conserved hypothetical protein |
|
|
Conserved hypothetical protein |
| Ajs_3947 |
|
Gene: Ajs_3947: Conserved hypothetical protein |
|
|
Gene: Lcho_1820: Conserved hypothetical protein |
Gene: Mpe_A2578: Conserved hypothetical protein |
Gene: Pnap_0052: Conserved hypothetical protein |
|
Gene: Rfer_2847: Conserved hypothetical protein |
|
|
Conserved hypothetical protein |
| CRON 2. | ||||||||||||
| fdoX |
|
|
|
|
*
Leptothrix cholodnii SP-6 Site: position = -39 score = 5.52393 sequence = ATATGCAGGCCTTTGCATGG Gene: Lcho_3729: Putative subunit of formate dehydrogenase |
|
|
*
Polaromonas sp. JS666 Site: position = -48 score = 5.84447 sequence = GTATGCAAACCGTTGCATAC Gene: Bpro_0936: Putative subunit of formate dehydrogenase |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -41 score = 6.12726 sequence = CTATGCAAATAGTTGCATAA Gene: Rfer_3262: Putative subunit of formate dehydrogenase |
|
|
Putative subunit of formate dehydrogenase |
| fdoG |
|
Gene: Ajs_3464: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
|
|
Gene: Lcho_3728: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Mpe_A1170: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Pnap_0834: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Bpro_0937: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
Gene: Rfer_3261: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
|
|
Formate dehydrogenase-O, major subunit (EC 1.2.1.2) |
| fdoH |
|
Gene: Ajs_3463: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) |
|
|
Gene: Lcho_3727: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) |
Gene: Mpe_A1171: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) |
Gene: Pnap_0835: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) |
Gene: Bpro_0938: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) |
Gene: Rfer_3260: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) |
|
|
Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) |
| fdoY |
|
Gene: Ajs_3462: Putative subunit of formate dehydrogenase |
|
|
Gene: Lcho_3726: Putative subunit of formate dehydrogenase |
Gene: Mpe_A1172: Putative subunit of formate dehydrogenase |
Gene: Pnap_0836: Putative subunit of formate dehydrogenase |
Gene: Bpro_0939: Putative subunit of formate dehydrogenase |
Gene: Rfer_3259: Putative subunit of formate dehydrogenase |
|
|
Putative subunit of formate dehydrogenase |
| fdoI |
|
Gene: Ajs_3461: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) |
|
|
Gene: Lcho_3725: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) |
Gene: Mpe_A1173: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) |
Gene: Pnap_0837: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) |
Gene: Bpro_0940: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) |
Gene: Rfer_3258: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) |
|
|
Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) |
| fdoZ |
|
Gene: Ajs_3460: Putative subunit of formate dehydrogenase |
|
|
Gene: Lcho_3724: Putative subunit of formate dehydrogenase |
Gene: Mpe_A1174: Putative subunit of formate dehydrogenase |
Gene: Pnap_0838: Putative subunit of formate dehydrogenase |
Gene: Bpro_0941: Putative subunit of formate dehydrogenase |
Gene: Rfer_3257: Putative subunit of formate dehydrogenase |
|
|
Putative subunit of formate dehydrogenase |
| fdhD |
|
Gene: Ajs_3459: Formate dehydrogenase chain D (EC 1.2.1.2) |
|
|
Gene: Lcho_3723: Formate dehydrogenase chain D (EC 1.2.1.2) |
Gene: Mpe_A1176: Formate dehydrogenase chain D (EC 1.2.1.2) |
Gene: Pnap_0839: Formate dehydrogenase chain D (EC 1.2.1.2) |
Gene: Bpro_0942: Formate dehydrogenase chain D (EC 1.2.1.2) |
Gene: Rfer_3256: Formate dehydrogenase chain D (EC 1.2.1.2) |
|
|
Formate dehydrogenase chain D (EC 1.2.1.2) |
| CRON 3. | ||||||||||||
| tupA |
|
*
Acidovorax sp. JS42 Site: position = -58 score = 5.91135 sequence = CTATGCACAAGTTTTCATAT Gene: Ajs_3129: Tungstate ABC-type transporter, permease protein |
|
|
Gene: Lcho_1813: Tungstate ABC-type transporter, permease protein |
*
Methylibium petroleiphilum PM1 Site: position = -102 score = 5.32755 sequence = CTATGCATGCTCGTTCATAT Gene: Mpe_A2223: Tungstate ABC-type transporter, permease protein |
*
Polaromonas naphthalenivorans CJ2 Site: position = -84 score = 5.75948 sequence = CTATGCAAACAGCTTCATAA Gene: Pnap_1509: Tungstate ABC-type transporter, permease protein |
*
Polaromonas sp. JS666 Site: position = -85 score = 5.76943 sequence = CTATGCAAACCCATTCATAA Gene: Bpro_1758: Tungstate ABC-type transporter, permease protein |
*
Rhodoferax ferrireducens DSM 15236 Site: position = -58 score = 5.22138 sequence = CTATGCACGGTGGTTCATAT Gene: Rfer_2869: Tungstate ABC-type transporter, permease protein |
*
Variovorax paradoxus S110 Site: position = -74 score = 6.06821 sequence = CTATGCAAAATCCTGCATAG Gene: Vapar_1588: Tungstate ABC-type transporter, permease protein |
|
Tungstate ABC-type transporter, permease protein |
| tupC |
|
Gene: Ajs_3128: Tungstate ABC-type transporter, ATP-binding protein |
|
|
Gene: Lcho_1814: Tungstate ABC-type transporter, ATP-binding protein |
Gene: Mpe_A2222: Tungstate ABC-type transporter, ATP-binding protein |
Gene: Pnap_1510: Tungstate ABC-type transporter, ATP-binding protein |
Gene: Bpro_1759: Tungstate ABC-type transporter, ATP-binding protein |
Gene: Rfer_2868: Tungstate ABC-type transporter, ATP-binding protein |
Gene: Vapar_1589: Tungstate ABC-type transporter, ATP-binding protein |
|
Tungstate ABC-type transporter, ATP-binding protein |
| tupB |
|
Gene: Ajs_3127: Tungstate ABC-type transporter, substrate-binding protein |
|
|
Gene: Lcho_1815: Tungstate ABC-type transporter, substrate-binding protein |
Gene: Mpe_A2221: Tungstate ABC-type transporter, substrate-binding protein |
Gene: Pnap_1511: Tungstate ABC-type transporter, substrate-binding protein |
Gene: Bpro_1760: Tungstate ABC-type transporter, substrate-binding protein |
Gene: Rfer_2867: Tungstate ABC-type transporter, substrate-binding protein |
Gene: Vapar_1590: Tungstate ABC-type transporter, substrate-binding protein |
|
Tungstate ABC-type transporter, substrate-binding protein |
| modA |
|
|
|
|
|
Gene: Mpe_A2220: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
|
|
|
|
|
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |