Regulon of ModE3 in Leptothrix cholodnii SP-6

Properties
Regulator type:	Transcription factor
TF locus tag:	Lcho_1822
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Tungsten homeostasis
Effector:	Tungsten
Regulog:	ModE3 - Comamonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Tungsten
By pathway - Tungsten homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.5 Sequence: ATATGCAGGCCTTTGCATGG Locus tag: Lcho_3729 Name: fdoX Funciton: Putative subunit of formate dehydrogenase Locus tag: Lcho_3728 Name: fdoG Funciton: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) Locus tag: Lcho_3727 Name: fdoH Funciton: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) Locus tag: Lcho_3726 Name: fdoY Funciton: Putative subunit of formate dehydrogenase Locus tag: Lcho_3725 Name: fdoI Funciton: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) Locus tag: Lcho_3724 Name: fdoZ Funciton: Putative subunit of formate dehydrogenase Locus tag: Lcho_3723 Name: fdhD Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
	Lcho_3729	fdoX	Putative subunit of formate dehydrogenase
	Lcho_3728	fdoG	Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
	Lcho_3727	fdoH	Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
	Lcho_3726	fdoY	Putative subunit of formate dehydrogenase
	Lcho_3725	fdoI	Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
	Lcho_3724	fdoZ	Putative subunit of formate dehydrogenase
	Lcho_3723	fdhD	Formate dehydrogenase chain D (EC 1.2.1.2)
Position: -91 Score: 6.2 Sequence: CTATGCAGATGATTGCATAG Locus tag: Lcho_1816 Name: Ajs_3943 Funciton: NADH-dependent dehydrogenase, iron-sulfur binding protein Locus tag: Lcho_1817 Name: Ajs_3944 Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase Locus tag: Lcho_1818 Name: Ajs_3945 Funciton: NADH-dependent dehydrogenase, NADH-binding subunit Locus tag: Lcho_1819 Name: Ajs_3946 Funciton: Conserved hypothetical protein Locus tag: Lcho_1820 Name: Ajs_3947 Funciton: Conserved hypothetical protein
	Lcho_1816	Ajs_3943	NADH-dependent dehydrogenase, iron-sulfur binding protein
	Lcho_1817	Ajs_3944	Tungsten-containing aldehyde ferredoxin oxidoreductase
	Lcho_1818	Ajs_3945	NADH-dependent dehydrogenase, NADH-binding subunit
	Lcho_1819	Ajs_3946	Conserved hypothetical protein
	Lcho_1820	Ajs_3947	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD