Regulon of ModE3 in Polaromonas naphthalenivorans CJ2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pnap_1508
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Tungsten homeostasis
Effector:	Tungsten
Regulog:	ModE3 - Comamonadaceae
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Tungsten
By pathway - Tungsten homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 5.9 Sequence: CTATGCAAATCAATTCATAG Locus tag: Pnap_0048 Name: Ajs_3943 Funciton: NADH-dependent dehydrogenase, iron-sulfur binding protein Locus tag: Pnap_0049 Name: Ajs_3944 Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase Locus tag: Pnap_0050 Name: Ajs_3945 Funciton: NADH-dependent dehydrogenase, NADH-binding subunit Locus tag: Pnap_0051 Name: Ajs_3946 Funciton: Conserved hypothetical protein Locus tag: Pnap_0052 Name: Ajs_3947 Funciton: Conserved hypothetical protein
	Pnap_0048	Ajs_3943	NADH-dependent dehydrogenase, iron-sulfur binding protein
	Pnap_0049	Ajs_3944	Tungsten-containing aldehyde ferredoxin oxidoreductase
	Pnap_0050	Ajs_3945	NADH-dependent dehydrogenase, NADH-binding subunit
	Pnap_0051	Ajs_3946	Conserved hypothetical protein
	Pnap_0052	Ajs_3947	Conserved hypothetical protein
Position: -84 Score: 5.8 Sequence: CTATGCAAACAGCTTCATAA Locus tag: Pnap_1509 Name: tupA Funciton: Tungstate ABC-type transporter, permease protein Locus tag: Pnap_1510 Name: tupC Funciton: Tungstate ABC-type transporter, ATP-binding protein Locus tag: Pnap_1511 Name: tupB Funciton: Tungstate ABC-type transporter, substrate-binding protein
	Pnap_1509	tupA	Tungstate ABC-type transporter, permease protein
	Pnap_1510	tupC	Tungstate ABC-type transporter, ATP-binding protein
	Pnap_1511	tupB	Tungstate ABC-type transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD