Regulon of ModE3 in Rhodoferax ferrireducens DSM 15236

Properties
Regulator type:	Transcription factor
TF locus tag:	Rfer_2870
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Tungsten homeostasis
Effector:	Tungsten
Regulog:	ModE3 - Comamonadaceae
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Tungsten
By pathway - Tungsten homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 6.1 Sequence: CTATGCAAATAGTTGCATAA Locus tag: Rfer_3262 Name: fdoX Funciton: Putative subunit of formate dehydrogenase Locus tag: Rfer_3261 Name: fdoG Funciton: Formate dehydrogenase-O, major subunit (EC 1.2.1.2) Locus tag: Rfer_3260 Name: fdoH Funciton: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2) Locus tag: Rfer_3259 Name: fdoY Funciton: Putative subunit of formate dehydrogenase Locus tag: Rfer_3258 Name: fdoI Funciton: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2) Locus tag: Rfer_3257 Name: fdoZ Funciton: Putative subunit of formate dehydrogenase Locus tag: Rfer_3256 Name: fdhD Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
	Rfer_3262	fdoX	Putative subunit of formate dehydrogenase
	Rfer_3261	fdoG	Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
	Rfer_3260	fdoH	Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
	Rfer_3259	fdoY	Putative subunit of formate dehydrogenase
	Rfer_3258	fdoI	Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
	Rfer_3257	fdoZ	Putative subunit of formate dehydrogenase
	Rfer_3256	fdhD	Formate dehydrogenase chain D (EC 1.2.1.2)
Position: -58 Score: 5.2 Sequence: CTATGCACGGTGGTTCATAT Locus tag: Rfer_2869 Name: tupA Funciton: Tungstate ABC-type transporter, permease protein Locus tag: Rfer_2868 Name: tupC Funciton: Tungstate ABC-type transporter, ATP-binding protein Locus tag: Rfer_2867 Name: tupB Funciton: Tungstate ABC-type transporter, substrate-binding protein
	Rfer_2869	tupA	Tungstate ABC-type transporter, permease protein
	Rfer_2868	tupC	Tungstate ABC-type transporter, ATP-binding protein
	Rfer_2867	tupB	Tungstate ABC-type transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD