Regulon of ModE3 in Variovorax paradoxus S110

Properties
Regulator type:	Transcription factor
TF locus tag:	Vapar_1577
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Tungsten homeostasis
Effector:	Tungsten
Regulog:	ModE3 - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By trascription factor - ModE
By taxonomy - Comamonadaceae
By TF family - ModE
By effector - Tungsten
By pathway - Tungsten homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 6.1 Sequence: CTATGCAAAATCCTGCATAG Locus tag: Vapar_1588 Name: tupA Funciton: Tungstate ABC-type transporter, permease protein Locus tag: Vapar_1589 Name: tupC Funciton: Tungstate ABC-type transporter, ATP-binding protein Locus tag: Vapar_1590 Name: tupB Funciton: Tungstate ABC-type transporter, substrate-binding protein
	Vapar_1588	tupA	Tungstate ABC-type transporter, permease protein
	Vapar_1589	tupC	Tungstate ABC-type transporter, ATP-binding protein
	Vapar_1590	tupB	Tungstate ABC-type transporter, substrate-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD