Regulog LldR - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	activator (repressor)
Biological process:	Lactate utilization
Effector:	L-lactate
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LysR
By effector - L-lactate
By pathway - Lactate utilization

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	3	1
Shewanella putrefaciens CN-32	3	1
Shewanella sp W3-18-1	3	1
Shewanella sp ANA-3	3	1
Shewanella sp MR-4	3	1
Shewanella sp MR-7	3	1
Shewanella baltica OS155	3	1
Shewanella denitrificans OS217
Shewanella frigidimarina NCIMB 400	3	1
Shewanella amazonensis SB2B	3	1
Shewanella loihica PV-4	3	1
Shewanella pealeana ATCC 700345	3	1
Shewanella halifaxensis HAW-EB4	3	1
Shewanella piezotolerans WP3	3	1
Shewanella sediminis HAW-EB3	3	1
Shewanella woodyi ATCC 51908

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
lldE	* Shewanella oneidensis MR-1 Site: position = -123 score = 6.24847 sequence = TAAATTAGGGCTACTTATTTA Gene: SO_1520: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella putrefaciens CN-32 Site: position = -123 score = 6.23677 sequence = TAAATTAGGACTACTTATTTC Gene: Sputcn32_1270: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella sp W3-18-1 Site: position = -123 score = 6.23677 sequence = TAAATTAGGACTACTTATTTC Gene: Sputw3181_2836: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella sp ANA-3 Site: position = -91 score = 6.3277 sequence = TAAATTAGCGCTACTTATTTA Gene: Shewana3_2906: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella sp MR-4 Site: position = -123 score = 6.3277 sequence = TAAATTAGCGCTACTTATTTA Gene: Shewmr4_2736: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella sp MR-7 Site: position = -123 score = 6.3277 sequence = TAAATTAGCGCTACTTATTTA Gene: Shewmr7_2809: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella baltica OS155 Site: position = -123 score = 5.68827 sequence = TAAATTAGGGCTACTTATTCC Gene: Sbal_1352: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	Shewanella denitrificans OS217	* Shewanella frigidimarina NCIMB 400 Site: position = -133 score = 5.19693 sequence = TTAATTAGCACTACATTTTAT Gene: Sfri_1852: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella amazonensis SB2B Site: position = -115 score = 4.06734 sequence = TActaAAtTACcACTAtTTTA Gene: Sama_2441: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella loihica PV-4 Site: position = -154 score = 6.10506 sequence = TAAATTAGCACTACTTATTAT Gene: Shew_3004: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella pealeana ATCC 700345 Site: position = -168 score = 5.81653 sequence = TAAATTAGCACTACTTTTTAC Gene: Spea_2996: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella halifaxensis HAW-EB4 Site: position = -168 score = 5.81653 sequence = TAAATTAGCACTACTTTTTAC Gene: Shal_3085: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella piezotolerans WP3 Site: position = -154 score = 5.77814 sequence = TAAATTAGCACTACTTTTTAT Gene: swp_3635: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	* Shewanella sediminis HAW-EB3 Site: position = -149 score = 6.10506 sequence = TAAATTAGCACTACTTATTAT Gene: Ssed_3924: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE	Shewanella woodyi ATCC 51908	Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
lldF	Shewanella oneidensis MR-1 Gene: SO_1519: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella putrefaciens CN-32 Gene: Sputcn32_1269: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella sp W3-18-1 Gene: Sputw3181_2837: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella sp ANA-3 Gene: Shewana3_2907: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella sp MR-4 Gene: Shewmr4_2737: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella sp MR-7 Gene: Shewmr7_2810: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella baltica OS155 Gene: Sbal_1351: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1853: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella amazonensis SB2B Gene: Sama_2442: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella loihica PV-4 Gene: Shew_3005: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella pealeana ATCC 700345 Gene: Spea_2997: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella halifaxensis HAW-EB4 Gene: Shal_3086: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella piezotolerans WP3 Gene: swp_3636: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella sediminis HAW-EB3 Gene: Ssed_3923: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF	Shewanella woodyi ATCC 51908	Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
lldG	Shewanella oneidensis MR-1 Gene: SO_1518: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella putrefaciens CN-32 Gene: Sputcn32_1268: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella sp W3-18-1 Gene: Sputw3181_2838: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella sp ANA-3 Gene: Shewana3_2908: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella sp MR-4 Gene: Shewmr4_2738: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella sp MR-7 Gene: Shewmr7_2811: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella baltica OS155 Gene: Sbal_1350: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella denitrificans OS217	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1854: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella amazonensis SB2B Gene: Sama_2443: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella loihica PV-4 Gene: Shew_3006: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella pealeana ATCC 700345 Gene: Spea_2998: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella halifaxensis HAW-EB4 Gene: Shal_3087: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella piezotolerans WP3 Gene: swp_3637: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella sediminis HAW-EB3 Gene: Ssed_3922: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518	Shewanella woodyi ATCC 51908	Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog LldR - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --