Regulon of LldR in Shewanella sp MR-7

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr7_1172
Regulator family:	LysR
Regulation mode:	activator (repressor)
Biological process:	Lactate utilization
Effector:	L-lactate
Regulog:	LldR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LysR
By effector - L-lactate
By pathway - Lactate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -123 Score: 6.3 Sequence: TAAATTAGCGCTACTTATTTA Locus tag: Shewmr7_2809 Name: lldE Funciton: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE Locus tag: Shewmr7_2810 Name: lldF Funciton: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF Locus tag: Shewmr7_2811 Name: lldG Funciton: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
	Shewmr7_2809	lldE	Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
	Shewmr7_2810	lldF	Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
	Shewmr7_2811	lldG	Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD