Profile of regulator LldR in Shewanellaceae

Member of regulog collections

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Shewanella oneidensis MR-1
	SO_1520	lldE	-123	6.2	TAAATTAGGGCTACTTATTTA
Shewanella putrefaciens CN-32
	Sputcn32_1270	lldE	-123	6.2	TAAATTAGGACTACTTATTTC
Shewanella sp W3-18-1
	Sputw3181_2836	lldE	-123	6.2	TAAATTAGGACTACTTATTTC
Shewanella sp ANA-3
	Shewana3_2906	lldE	-91	6.3	TAAATTAGCGCTACTTATTTA
Shewanella sp MR-4
	Shewmr4_2736	lldE	-123	6.3	TAAATTAGCGCTACTTATTTA
Shewanella sp MR-7
	Shewmr7_2809	lldE	-123	6.3	TAAATTAGCGCTACTTATTTA
Shewanella baltica OS155
	Sbal_1352	lldE	-123	5.7	TAAATTAGGGCTACTTATTCC
Shewanella frigidimarina NCIMB 400
	Sfri_1852	lldE	-133	5.2	TTAATTAGCACTACATTTTAT
Shewanella amazonensis SB2B
	Sama_2441	lldE	-115	4.1	TActaAAtTACcACTAtTTTA
Shewanella loihica PV-4
	Shew_3004	lldE	-154	6.1	TAAATTAGCACTACTTATTAT
Shewanella pealeana ATCC 700345
	Spea_2996	lldE	-168	5.8	TAAATTAGCACTACTTTTTAC
Shewanella halifaxensis HAW-EB4
	Shal_3085	lldE	-168	5.8	TAAATTAGCACTACTTTTTAC
Shewanella piezotolerans WP3
	swp_3635	lldE	-154	5.8	TAAATTAGCACTACTTTTTAT
Shewanella sediminis HAW-EB3
	Ssed_3924	lldE	-149	6.1	TAAATTAGCACTACTTATTAT

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --