Regulon of LldR in Shewanella oneidensis MR-1
Regulator type: | Transcription factor |
TF locus tag: | SO_3460 |
Regulator family: | LysR |
Regulation mode: | activator (repressor) |
Biological process: | Lactate utilization |
Effector: | L-lactate |
Regulog: | LldR - Shewanellaceae |
Statistics of regulated genes: | |
- Genes | 3 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - LysR
- By effector - L-lactate
- By pathway - Lactate utilization
Locus Tag | Name | Function | |
---|---|---|---|
Position: -123
Score: 6.2 Sequence: TAAATTAGGGCTACTTATTTA
Locus tag: SO_1520
Name: lldE Funciton: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
Locus tag: SO_1519
Name: lldF Funciton: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
Locus tag: SO_1518
Name: lldG Funciton: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518 |
|||
lldE
|
Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
|
||
lldF
|
Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
|
||
lldG
|
Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |