Regulon of LldR in Shewanella sp MR-4
| Regulator type: | Transcription factor |
| TF locus tag: | Shewmr4_1106 |
| Regulator family: | LysR |
| Regulation mode: | activator (repressor) |
| Biological process: | Lactate utilization |
| Effector: | L-lactate |
| Regulog: | LldR - Shewanellaceae |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - LysR
- By effector - L-lactate
- By pathway - Lactate utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -123
Score: 6.3 Sequence: TAAATTAGCGCTACTTATTTA
Locus tag: Shewmr4_2736
Name: lldE Funciton: Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
Locus tag: Shewmr4_2737
Name: lldF Funciton: Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
Locus tag: Shewmr4_2738
Name: lldG Funciton: Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518 |
|||
|
lldE
|
Predicted L-lactate dehydrogenase, Fe-S oxidoreductase subunit YkgE
|
||
|
lldF
|
Predicted L-lactate dehydrogenase, Iron-sulfur cluster-binding subunit YkgF
|
||
|
lldG
|
Predicted L-lactate dehydrogenase, hypothetical protein subunit SO1518
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |