Regulog ELI_12480 - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | 7 | 4 |
| Erythrobacter sp. NAP1 | 9 | 5 |
| Novosphingobium aromaticivorans DSM 12444 | 6 | 3 |
| Sphingobium japonicum UT26S | 7 | 4 |
| Sphingopyxis alaskensis RB2256 | 7 | 4 |
| Sphingomonas wittichii RW1 | 5 | 3 |
| Zymomonas mobilis subsp. mobilis ZM4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| NAP1_15423 |
|
*
Erythrobacter sp. NAP1 Site: position = -60 score = 4.92844 sequence = AGGCGCTTTACACAAGTAACACACCA Gene: NAP1_15423: ABC transporter ATP-binding protein |
|
|
|
|
|
ABC transporter ATP-binding protein |
| NAP1_15428 |
|
Gene: NAP1_15428: membrane protein, putative |
|
|
|
|
|
membrane protein, putative |
| CRON 2. | ||||||||
| pbp |
*
Erythrobacter litoralis HTCC2594 Site: position = -28 score = 4.11019 sequence = CGCTGTGTTATCCTGCTAATACAGCC Gene: ELI_02675: penicillin-binding protein |
*
Erythrobacter sp. NAP1 Site: position = -30 score = 4.05533 sequence = GGCTGTATTAGGCTGCTAACACAGTG Gene: NAP1_01960: penicillin-binding protein |
|
*
Sphingobium japonicum UT26S Site: position = -25 score = 4.13001 sequence = GACCGTGTCAGGCAAATAACACAGCA Gene: SJA_C1-22810: penicillin-binding protein |
*
Sphingopyxis alaskensis RB2256 Site: position = 1 score = 3.78096 sequence = TGCTGTGTTGGGGTTGTAATACGGCC Gene: Sala_1453: penicillin-binding protein |
|
|
penicillin-binding protein |
| CRON 3. | ||||||||
| ELI_11155 |
*
Erythrobacter litoralis HTCC2594 Site: position = -49 score = 4.36744 sequence = TCGTGTCTTAGACACCTAATACAGTT Gene: ELI_11155: Uncharacterized protein involved in tellurite resistance |
*
Erythrobacter sp. NAP1 Site: position = -90 score = 4.87887 sequence = GCGTGTTTTAGATCACTAATACAGTA Gene: NAP1_15233: Uncharacterized protein involved in tellurite resistance |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -49 score = 4.30667 sequence = CGCTGTGTTGCGTGTATAAGACAGCT Gene: Saro_2959: Uncharacterized protein involved in tellurite resistance |
*
Sphingobium japonicum UT26S Site: position = -55 score = 4.36897 sequence = AACTGTTCTATACGCATATAACAGTT Gene: SJA_C1-07830: Uncharacterized protein involved in tellurite resistance |
*
Sphingopyxis alaskensis RB2256 Site: position = -85 score = 4.7397 sequence = CAGTGTAATGCTTGTATAATACAGTG Gene: Sala_2308: Uncharacterized protein involved in tellurite resistance |
*
Sphingomonas wittichii RW1 Site: position = -72 score = 3.3402 sequence = CGCCGTATCGCTTGAATAATGCACCC Gene: Swit_0261: Uncharacterized protein involved in tellurite resistance |
Gene: ZMO1385: Uncharacterized protein involved in tellurite resistance |
Uncharacterized protein involved in tellurite resistance |
| ELI_11160 |
Gene: ELI_11160: hypothetical protein |
Gene: NAP1_15228: hypothetical protein |
Gene: Saro_2958: hypothetical protein |
Gene: SJA_C1-07820: hypothetical protein |
Gene: Sala_2309: hypothetical protein |
Gene: Swit_0260: hypothetical protein |
Gene: ZMO1386: hypothetical protein |
hypothetical protein |
| CRON 4. | ||||||||
| rndA |
*
Erythrobacter litoralis HTCC2594 Site: position = -55 score = 4.52015 sequence = AGGTGACTTATATAGGTAATACAGCG Gene: ELI_13485: RND family efflux transporter MFP subunit |
*
Erythrobacter sp. NAP1 Site: position = -73 score = 4.3934 sequence = GGGTGACTTATACGTATAACACACTT Gene: NAP1_12603: RND family efflux transporter MFP subunit |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -81 score = 4.67271 sequence = AAGTGTGTTATATGTATAGCACGCTA Gene: Saro_0040: RND family efflux transporter MFP subunit |
*
Sphingobium japonicum UT26S Site: position = -63 score = 5.17902 sequence = GGGTGATGTATTCATATAATACAGCA Gene: SJA_C1-02860: RND family efflux transporter MFP subunit |
*
Sphingopyxis alaskensis RB2256 Site: position = -100 score = 4.85875 sequence = CGGTGATTTAATTAGGTAATACACCT Gene: Sala_0471: RND family efflux transporter MFP subunit |
*
Sphingomonas wittichii RW1 Site: position = -70 score = 4.18177 sequence = AGGTGACGTATTGAGATAATACAGCT Gene: Swit_4745: RND family efflux transporter MFP subunit |
Gene: ZMO0287: RND family efflux transporter MFP subunit |
RND family efflux transporter MFP subunit |
| rndB |
Gene: ELI_13490: RND multidrug efflux transporter transmembrane subunit |
Gene: NAP1_12598: RND multidrug efflux transporter transmembrane subunit |
Gene: Saro_0039: RND multidrug efflux transporter transmembrane subunit |
Gene: SJA_C1-02870: RND multidrug efflux transporter transmembrane subunit |
Gene: Sala_0472: RND multidrug efflux transporter transmembrane subunit |
Gene: Swit_4744: RND multidrug efflux transporter transmembrane subunit |
|
RND multidrug efflux transporter transmembrane subunit |
| COG2733 |
Gene: ELI_13495: Predicted membrane protein |
Gene: NAP1_12593: Predicted membrane protein |
Gene: Saro_0038: Predicted membrane protein |
Gene: SJA_C1-02880: Predicted membrane protein |
Gene: Sala_0473: Predicted membrane protein |
Gene: Swit_4743: Predicted membrane protein |
Gene: ZMO0290: Predicted membrane protein |
Predicted membrane protein |
| CRON 5. | ||||||||
| ELI_12480 |
*
Erythrobacter litoralis HTCC2594 Site: position = -26 score = 4.37228 sequence = CGGTGTATTATGGCACTGAAGCACCC Gene: ELI_12480: Transcriptional regulator, GntR family |
*
Erythrobacter sp. NAP1 Site: position = -41 score = 3.76632 sequence = GGCTGTATTATGGCACTGAAGCACCT Gene: NAP1_13568: Transcriptional regulator, GntR family |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = 22 score = 4.29006 sequence = GGCTGTATTATGGCAATATAGCACCC Gene: Saro_0164: Transcriptional regulator, GntR family |
*
Sphingobium japonicum UT26S Site: position = -25 score = 4.29986 sequence = CGCTGTATTATGGCACTGATGCACCA Gene: SJA_C1-23280: Transcriptional regulator, GntR family |
*
Sphingopyxis alaskensis RB2256 Site: position = -25 score = 4.74838 sequence = TGCTGTCTTATGGCATTAAGTCGCCA Gene: Sala_0952: Transcriptional regulator, GntR family |
*
Sphingomonas wittichii RW1 Site: position = -25 score = 4.83064 sequence = TGCTGTGTTAGCACAGTGTGACGCCA Gene: Swit_0076: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |