Regulon of ELI_12480 in Novosphingobium aromaticivorans DSM 12444

Properties
Regulator type:	Transcription factor
TF locus tag:	Saro_0164
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	ELI_12480 - Sphingomonadales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 4.7 Sequence: AAGTGTGTTATATGTATAGCACGCTA Locus tag: Saro_0040 Name: rndA Funciton: RND family efflux transporter MFP subunit Locus tag: Saro_0039 Name: rndB Funciton: RND multidrug efflux transporter transmembrane subunit Locus tag: Saro_0038 Name: COG2733 Funciton: Predicted membrane protein
	Saro_0040	rndA	RND family efflux transporter MFP subunit
	Saro_0039	rndB	RND multidrug efflux transporter transmembrane subunit
	Saro_0038	COG2733	Predicted membrane protein
Position: -49 Score: 4.3 Sequence: CGCTGTGTTGCGTGTATAAGACAGCT Locus tag: Saro_2959 Name: ELI_11155 Funciton: Uncharacterized protein involved in tellurite resistance Locus tag: Saro_2958 Name: ELI_11160 Funciton: hypothetical protein
	Saro_2959	ELI_11155	Uncharacterized protein involved in tellurite resistance
	Saro_2958	ELI_11160	hypothetical protein
Position: 22 Score: 4.3 Sequence: GGCTGTATTATGGCAATATAGCACCC Locus tag: Saro_0164 Name: ELI_12480 Funciton: Transcriptional regulator, GntR family
	Saro_0164	ELI_12480	Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD