Regulon of ELI_12480 in Sphingopyxis alaskensis RB2256

Properties
Regulator type:	Transcription factor
TF locus tag:	Sala_0952
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	ELI_12480 - Sphingomonadales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -100 Score: 4.9 Sequence: CGGTGATTTAATTAGGTAATACACCT Locus tag: Sala_0471 Name: rndA Funciton: RND family efflux transporter MFP subunit Locus tag: Sala_0472 Name: rndB Funciton: RND multidrug efflux transporter transmembrane subunit Locus tag: Sala_0473 Name: COG2733 Funciton: Predicted membrane protein
	Sala_0471	rndA	RND family efflux transporter MFP subunit
	Sala_0472	rndB	RND multidrug efflux transporter transmembrane subunit
	Sala_0473	COG2733	Predicted membrane protein
Position: -85 Score: 4.7 Sequence: CAGTGTAATGCTTGTATAATACAGTG Locus tag: Sala_2308 Name: ELI_11155 Funciton: Uncharacterized protein involved in tellurite resistance Locus tag: Sala_2309 Name: ELI_11160 Funciton: hypothetical protein
	Sala_2308	ELI_11155	Uncharacterized protein involved in tellurite resistance
	Sala_2309	ELI_11160	hypothetical protein
Position: -25 Score: 4.7 Sequence: TGCTGTCTTATGGCATTAAGTCGCCA Locus tag: Sala_0952 Name: ELI_12480 Funciton: Transcriptional regulator, GntR family
	Sala_0952	ELI_12480	Transcriptional regulator, GntR family
Position: 1 Score: 3.8 Sequence: TGCTGTGTTGGGGTTGTAATACGGCC Locus tag: Sala_1453 Name: pbp Funciton: penicillin-binding protein
	Sala_1453	pbp	penicillin-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD