Regulon of ELI_12480 in Erythrobacter litoralis HTCC2594

Properties
Regulator type:	Transcription factor
TF locus tag:	ELI_12480
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	ELI_12480 - Sphingomonadales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 4.5 Sequence: AGGTGACTTATATAGGTAATACAGCG Locus tag: ELI_13485 Name: rndA Funciton: RND family efflux transporter MFP subunit Locus tag: ELI_13490 Name: rndB Funciton: RND multidrug efflux transporter transmembrane subunit Locus tag: ELI_13495 Name: COG2733 Funciton: Predicted membrane protein
	ELI_13485	rndA	RND family efflux transporter MFP subunit
	ELI_13490	rndB	RND multidrug efflux transporter transmembrane subunit
	ELI_13495	COG2733	Predicted membrane protein
Position: -26 Score: 4.4 Sequence: CGGTGTATTATGGCACTGAAGCACCC Locus tag: ELI_12480 Name: ELI_12480 Funciton: Transcriptional regulator, GntR family
	ELI_12480	ELI_12480	Transcriptional regulator, GntR family
Position: -28 Score: 4.1 Sequence: CGCTGTGTTATCCTGCTAATACAGCC Locus tag: ELI_02675 Name: pbp Funciton: penicillin-binding protein
	ELI_02675	pbp	penicillin-binding protein
Position: -49 Score: 4.4 Sequence: TCGTGTCTTAGACACCTAATACAGTT Locus tag: ELI_11155 Name: ELI_11155 Funciton: Uncharacterized protein involved in tellurite resistance Locus tag: ELI_11160 Name: ELI_11160 Funciton: hypothetical protein
	ELI_11155	ELI_11155	Uncharacterized protein involved in tellurite resistance
	ELI_11160	ELI_11160	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD