Regulon of ELI_12480 in Sphingomonas wittichii RW1

Properties
Regulator type:	Transcription factor
TF locus tag:	Swit_0076
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	ELI_12480 - Sphingomonadales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 3.3 Sequence: CGCCGTATCGCTTGAATAATGCACCC Locus tag: Swit_0261 Name: ELI_11155 Funciton: Uncharacterized protein involved in tellurite resistance Locus tag: Swit_0260 Name: ELI_11160 Funciton: hypothetical protein
	Swit_0261	ELI_11155	Uncharacterized protein involved in tellurite resistance
	Swit_0260	ELI_11160	hypothetical protein
Position: -70 Score: 4.2 Sequence: AGGTGACGTATTGAGATAATACAGCT Locus tag: Swit_4745 Name: rndA Funciton: RND family efflux transporter MFP subunit Locus tag: Swit_4744 Name: rndB Funciton: RND multidrug efflux transporter transmembrane subunit
	Swit_4745	rndA	RND family efflux transporter MFP subunit
	Swit_4744	rndB	RND multidrug efflux transporter transmembrane subunit
Position: -25 Score: 4.8 Sequence: TGCTGTGTTAGCACAGTGTGACGCCA Locus tag: Swit_0076 Name: ELI_12480 Funciton: Transcriptional regulator, GntR family
	Swit_0076	ELI_12480	Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD