Statistics of regulated genes

Genome	Genes	Operons
Streptomyces avermitilis MA-4680	4	1
Streptomyces coelicolor A3(2)	3	1
Streptomyces griseus subsp. griseus NBRC 13350	9	3
Streptomyces scabiei 87.22	7	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes					Function
CRON 1.
lndYR	* Streptomyces avermitilis MA-4680 Site: position = -25 score = 5.87345 sequence = CTTTCACTACTCAATTAGTGAAAG Gene: SAV_4065: Transcriptional regulator of landomycin production, GntR family	* Streptomyces coelicolor A3(2) Site: position = -25 score = 5.41185 sequence = CTTCTACTAATGAATTAATGAAAG Gene: SCO0823: Transcriptional regulator of landomycin production, GntR family	*2 Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -25 score = 5.87345 sequence = CTTTCACTACTCAATTAGTGAAAG Gene: SGR_3939: Transcriptional regulator of landomycin production, GntR family Gene: SGR_3238: Transcriptional regulator of landomycin production, GntR family	*2 Streptomyces scabiei 87.22 Site: position = -28 score = 5.4846 sequence = AAATCACTAGTCGACTAGTGAATT Gene: SCAB_53951: Transcriptional regulator of landomycin production, GntR family Site: position = -36 score = 5.87345 sequence = CTTTCACTACTCAATTAGTGAAAG Gene: SCAB_49471: Transcriptional regulator of landomycin production, GntR family	Transcriptional regulator of landomycin production, GntR family
lndWA	Streptomyces avermitilis MA-4680 Gene: SAV_4066: Landomycin ABC transporter, ATP-binding protein	Streptomyces coelicolor A3(2) Gene: SCO0824: Landomycin ABC transporter, ATP-binding protein	*2 Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_3938: Landomycin ABC transporter, ATP-binding protein Site: position = -28 score = 5.6678 sequence = ATTCCATTAATTGACTAATGGAAT Gene: SGR_3236: Landomycin ABC transporter, ATP-binding protein	2 Streptomyces scabiei 87.22 Gene: SCAB_49461: Landomycin ABC transporter, ATP-binding protein Gene: SCAB_53961: Landomycin ABC transporter, ATP-binding protein	Landomycin ABC transporter, ATP-binding protein
lndWP	2 Streptomyces avermitilis MA-4680 Gene: SAV_4068: Landomycin ABC transporter, permease protein Gene: SAV_4067: Landomycin ABC transporter, permease protein	Streptomyces coelicolor A3(2) Gene: SCO0825: Landomycin ABC transporter, permease protein	2 Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_3937: Landomycin ABC transporter, permease protein Gene: SGR_3237: Landomycin ABC transporter, permease protein	3 Streptomyces scabiei 87.22 Gene: SCAB_49441: Landomycin ABC transporter, permease protein Gene: SCAB_53971: Landomycin ABC transporter, permease protein Gene: SCAB_49451: Landomycin ABC transporter, permease protein	Landomycin ABC transporter, permease protein
CRON 2.
SGR_2538	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2)	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -22 score = 4.60146 sequence = ATAGTGCTAGGCAACTAGATAAAT Gene: SGR_2538: putative GntR-family transcriptional regulator	Streptomyces scabiei 87.22	putative GntR-family transcriptional regulator
SGR_2537	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_2537: putative ABC transporter ATP-binding protein	Streptomyces scabiei 87.22	putative ABC transporter ATP-binding protein
SGR_2536	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2)	Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_2536: putative transmembrane transport protein	Streptomyces scabiei 87.22	putative transmembrane transport protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD