Regulog LndYR - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Antibiotic resistance |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - GntR/Others
- By pathway - Antibiotic resistance
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 4 | 1 |
| Streptomyces coelicolor A3(2) | 3 | 1 |
| Streptomyces griseus subsp. griseus NBRC 13350 | 9 | 3 |
| Streptomyces scabiei 87.22 | 7 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| lndYR |
*
Streptomyces avermitilis MA-4680 Site: position = -25 score = 5.87345 sequence = CTTTCACTACTCAATTAGTGAAAG Gene: SAV_4065: Transcriptional regulator of landomycin production, GntR family |
*
Streptomyces coelicolor A3(2) Site: position = -25 score = 5.41185 sequence = CTTCTACTAATGAATTAATGAAAG Gene: SCO0823: Transcriptional regulator of landomycin production, GntR family |
*2
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -25 score = 5.87345 sequence = CTTTCACTACTCAATTAGTGAAAG Gene: SGR_3939: Transcriptional regulator of landomycin production, GntR family Gene: SGR_3238: Transcriptional regulator of landomycin production, GntR family |
*2
Streptomyces scabiei 87.22 Site: position = -28 score = 5.4846 sequence = AAATCACTAGTCGACTAGTGAATT Gene: SCAB_53951: Transcriptional regulator of landomycin production, GntR family Site: position = -36 score = 5.87345 sequence = CTTTCACTACTCAATTAGTGAAAG Gene: SCAB_49471: Transcriptional regulator of landomycin production, GntR family |
Transcriptional regulator of landomycin production, GntR family |
| lndWA |
Gene: SAV_4066: Landomycin ABC transporter, ATP-binding protein |
Gene: SCO0824: Landomycin ABC transporter, ATP-binding protein |
*2
Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_3938: Landomycin ABC transporter, ATP-binding protein Site: position = -28 score = 5.6678 sequence = ATTCCATTAATTGACTAATGGAAT Gene: SGR_3236: Landomycin ABC transporter, ATP-binding protein |
2
Streptomyces scabiei 87.22 Gene: SCAB_49461: Landomycin ABC transporter, ATP-binding protein Gene: SCAB_53961: Landomycin ABC transporter, ATP-binding protein |
Landomycin ABC transporter, ATP-binding protein |
| lndWP |
2
Streptomyces avermitilis MA-4680 Gene: SAV_4068: Landomycin ABC transporter, permease protein Gene: SAV_4067: Landomycin ABC transporter, permease protein |
Gene: SCO0825: Landomycin ABC transporter, permease protein |
2
Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_3937: Landomycin ABC transporter, permease protein Gene: SGR_3237: Landomycin ABC transporter, permease protein |
3
Streptomyces scabiei 87.22 Gene: SCAB_49441: Landomycin ABC transporter, permease protein Gene: SCAB_53971: Landomycin ABC transporter, permease protein Gene: SCAB_49451: Landomycin ABC transporter, permease protein |
Landomycin ABC transporter, permease protein |
| CRON 2. | |||||
| SGR_2538 |
|
|
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -22 score = 4.60146 sequence = ATAGTGCTAGGCAACTAGATAAAT Gene: SGR_2538: putative GntR-family transcriptional regulator |
|
putative GntR-family transcriptional regulator |
| SGR_2537 |
|
|
Gene: SGR_2537: putative ABC transporter ATP-binding protein |
|
putative ABC transporter ATP-binding protein |
| SGR_2536 |
|
|
Gene: SGR_2536: putative transmembrane transport protein |
|
putative transmembrane transport protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |