Regulon of LndYR in Streptomyces avermitilis MA-4680

Properties
Regulator type:	Transcription factor
TF locus tag:	SAV_4065
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Antibiotic resistance
Effector:
Regulog:	LndYR - Streptomycetaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - GntR/Others
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -25 Score: 5.9 Sequence: CTTTCACTACTCAATTAGTGAAAG Locus tag: SAV_4065 Name: lndYR Funciton: Transcriptional regulator of landomycin production, GntR family Locus tag: SAV_4066 Name: lndWA Funciton: Landomycin ABC transporter, ATP-binding protein Locus tag: SAV_4067 Name: lndWP Funciton: Landomycin ABC transporter, permease protein Locus tag: SAV_4068 Name: lndWP Funciton: Landomycin ABC transporter, permease protein
	SAV_4065	lndYR	Transcriptional regulator of landomycin production, GntR family
	SAV_4066	lndWA	Landomycin ABC transporter, ATP-binding protein
	SAV_4067	lndWP	Landomycin ABC transporter, permease protein
	SAV_4068	lndWP	Landomycin ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD