Regulon of LndYR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_2538, SGR_3939, SGR_3238
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Antibiotic resistance
Effector:
Regulog:	LndYR - Streptomycetaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - GntR/Others
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -28 Score: 5.7 Sequence: ATTCCATTAATTGACTAATGGAAT Locus tag: SGR_3236 Name: lndWA Funciton: Landomycin ABC transporter, ATP-binding protein Locus tag: SGR_3237 Name: lndWP Funciton: Landomycin ABC transporter, permease protein Locus tag: SGR_3238 Name: lndYR Funciton: Transcriptional regulator of landomycin production, GntR family
	SGR_3236	lndWA	Landomycin ABC transporter, ATP-binding protein
	SGR_3237	lndWP	Landomycin ABC transporter, permease protein
	SGR_3238	lndYR	Transcriptional regulator of landomycin production, GntR family
Position: -22 Score: 4.6 Sequence: ATAGTGCTAGGCAACTAGATAAAT Locus tag: SGR_2538 Name: null Funciton: putative GntR-family transcriptional regulator Locus tag: SGR_2537 Name: null Funciton: putative ABC transporter ATP-binding protein Locus tag: SGR_2536 Name: null Funciton: putative transmembrane transport protein
	SGR_2538		putative GntR-family transcriptional regulator
	SGR_2537		putative ABC transporter ATP-binding protein
	SGR_2536		putative transmembrane transport protein
Position: -25 Score: 5.9 Sequence: CTTTCACTACTCAATTAGTGAAAG Locus tag: SGR_3939 Name: lndYR Funciton: Transcriptional regulator of landomycin production, GntR family Locus tag: SGR_3938 Name: lndWA Funciton: Landomycin ABC transporter, ATP-binding protein Locus tag: SGR_3937 Name: lndWP Funciton: Landomycin ABC transporter, permease protein
	SGR_3939	lndYR	Transcriptional regulator of landomycin production, GntR family
	SGR_3938	lndWA	Landomycin ABC transporter, ATP-binding protein
	SGR_3937	lndWP	Landomycin ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD