Regulon of LndYR in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Antibiotic resistance
Effector:
Regulog:	LndYR - Streptomycetaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - GntR/Others
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 5.9 Sequence: CTTTCACTACTCAATTAGTGAAAG Locus tag: SCAB_49471 Name: lndYR Funciton: Transcriptional regulator of landomycin production, GntR family Locus tag: SCAB_49461 Name: lndWA Funciton: Landomycin ABC transporter, ATP-binding protein Locus tag: SCAB_49451 Name: lndWP Funciton: Landomycin ABC transporter, permease protein Locus tag: SCAB_49441 Name: lndWP Funciton: Landomycin ABC transporter, permease protein
	SCAB_49471	lndYR	Transcriptional regulator of landomycin production, GntR family
	SCAB_49461	lndWA	Landomycin ABC transporter, ATP-binding protein
	SCAB_49451	lndWP	Landomycin ABC transporter, permease protein
	SCAB_49441	lndWP	Landomycin ABC transporter, permease protein
Position: -28 Score: 5.5 Sequence: AAATCACTAGTCGACTAGTGAATT Locus tag: SCAB_53951 Name: lndYR Funciton: Transcriptional regulator of landomycin production, GntR family Locus tag: SCAB_53961 Name: lndWA Funciton: Landomycin ABC transporter, ATP-binding protein Locus tag: SCAB_53971 Name: lndWP Funciton: Landomycin ABC transporter, permease protein
	SCAB_53951	lndYR	Transcriptional regulator of landomycin production, GntR family
	SCAB_53961	lndWA	Landomycin ABC transporter, ATP-binding protein
	SCAB_53971	lndWP	Landomycin ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD