Regulog PdxR3 - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/MocR |
| Regulation mode: | |
| Biological process: | Pyridoxine/pyridoxal homeostasis |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By trascription factor - PdxR
- By TF family - GntR/MocR
- By pathway - Pyridoxine/pyridoxal homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces avermitilis MA-4680 | 4 | 4 |
| Streptomyces coelicolor A3(2) | 4 | 2 |
| Streptomyces griseus subsp. griseus NBRC 13350 | 6 | 4 |
| Streptomyces scabiei 87.22 | 4 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| pdxR3 |
*
Streptomyces avermitilis MA-4680 Site: position = -31 score = 5.4764 sequence = TGGCCAATTCCGGGAAGGTGGACT Gene: SAV_6928: Transcriptional regulator, GntR/MocR family |
*
Streptomyces coelicolor A3(2) Site: position = -31 score = 5.55687 sequence = TGGCCAATTTGGGGAAGGTGGACT Gene: SCO1417: Transcriptional regulator, GntR/MocR family |
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -31 score = 4.97163 sequence = TGGCCAATTCGAGGAAGGTGGACT Gene: SGR_6115: Transcriptional regulator, GntR/MocR family |
*
Streptomyces scabiei 87.22 Site: position = -30 score = 5.25534 sequence = TGGCCAATTCGGGGAAGGTGGACT Gene: SCAB_75881: Transcriptional regulator, GntR/MocR family |
Transcriptional regulator, GntR/MocR family |
| CRON 2. | |||||
| pdxR3 |
*
Streptomyces avermitilis MA-4680 Site: position = -25 score = 3.83658 sequence = TAGCCAGATTGGCTAGGCTGGTTC Gene: SAV_980: Transcriptional regulator, GntR/MocR family |
|
*
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -25 score = 3.8006 sequence = TAGCCAGATTGGCTACGCTGGTCC Gene: SGR_4328: Transcriptional regulator, GntR/MocR family |
|
Transcriptional regulator, GntR/MocR family |
| CRON 3. | |||||
| COG2364 |
*2
Streptomyces avermitilis MA-4680 Site: position = -129 score = 3.83658 sequence = GAACCAGCCTAGCCAATCTGGCTA Gene: SAV_7578: Predicted membrane protein Site: position = 9 score = 5.4764 sequence = AGTCCACCTTCCCGGAATTGGCCA Gene: SAV_6929: Predicted membrane protein |
*
Streptomyces coelicolor A3(2) Site: position = -95 score = 5.55687 sequence = AGTCCACCTTCCCCAAATTGGCCA Gene: SCO1418: Predicted membrane protein |
*2
Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -95 score = 4.97163 sequence = AGTCCACCTTCCTCGAATTGGCCA Gene: SGR_6114: Predicted membrane protein Site: position = -129 score = 3.8006 sequence = GGACCAGCGTAGCCAATCTGGCTA Gene: SGR_4327: Predicted membrane protein |
*
Streptomyces scabiei 87.22 Site: position = -92 score = 5.25534 sequence = AGTCCACCTTCCCCGAATTGGCCA Gene: SCAB_75871: Predicted membrane protein |
Predicted membrane protein |
| COG0584 |
Gene: SAV_6927: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) |
Gene: SCO1419: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) |
Gene: SGR_6113: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) |
Gene: SCAB_75861: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) |
Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) |
| COG2270 |
Gene: SAV_6926: Permeases of the major facilitator superfamily |
Gene: SCO1420: Permeases of the major facilitator superfamily |
Gene: SGR_6112: Permeases of the major facilitator superfamily |
Gene: SCAB_75851: Permeases of the major facilitator superfamily |
Permeases of the major facilitator superfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |