Statistics of regulated genes

Genome	Genes	Operons
Streptomyces avermitilis MA-4680	4	4
Streptomyces coelicolor A3(2)	4	2
Streptomyces griseus subsp. griseus NBRC 13350	6	4
Streptomyces scabiei 87.22	4	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes					Function
CRON 1.
pdxR3	* Streptomyces avermitilis MA-4680 Site: position = -31 score = 5.4764 sequence = TGGCCAATTCCGGGAAGGTGGACT Gene: SAV_6928: Transcriptional regulator, GntR/MocR family	* Streptomyces coelicolor A3(2) Site: position = -31 score = 5.55687 sequence = TGGCCAATTTGGGGAAGGTGGACT Gene: SCO1417: Transcriptional regulator, GntR/MocR family	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -31 score = 4.97163 sequence = TGGCCAATTCGAGGAAGGTGGACT Gene: SGR_6115: Transcriptional regulator, GntR/MocR family	* Streptomyces scabiei 87.22 Site: position = -30 score = 5.25534 sequence = TGGCCAATTCGGGGAAGGTGGACT Gene: SCAB_75881: Transcriptional regulator, GntR/MocR family	Transcriptional regulator, GntR/MocR family
CRON 2.
pdxR3	* Streptomyces avermitilis MA-4680 Site: position = -25 score = 3.83658 sequence = TAGCCAGATTGGCTAGGCTGGTTC Gene: SAV_980: Transcriptional regulator, GntR/MocR family	Streptomyces coelicolor A3(2)	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -25 score = 3.8006 sequence = TAGCCAGATTGGCTACGCTGGTCC Gene: SGR_4328: Transcriptional regulator, GntR/MocR family	Streptomyces scabiei 87.22	Transcriptional regulator, GntR/MocR family
CRON 3.
COG2364	*2 Streptomyces avermitilis MA-4680 Site: position = -129 score = 3.83658 sequence = GAACCAGCCTAGCCAATCTGGCTA Gene: SAV_7578: Predicted membrane protein Site: position = 9 score = 5.4764 sequence = AGTCCACCTTCCCGGAATTGGCCA Gene: SAV_6929: Predicted membrane protein	* Streptomyces coelicolor A3(2) Site: position = -95 score = 5.55687 sequence = AGTCCACCTTCCCCAAATTGGCCA Gene: SCO1418: Predicted membrane protein	*2 Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -95 score = 4.97163 sequence = AGTCCACCTTCCTCGAATTGGCCA Gene: SGR_6114: Predicted membrane protein Site: position = -129 score = 3.8006 sequence = GGACCAGCGTAGCCAATCTGGCTA Gene: SGR_4327: Predicted membrane protein	* Streptomyces scabiei 87.22 Site: position = -92 score = 5.25534 sequence = AGTCCACCTTCCCCGAATTGGCCA Gene: SCAB_75871: Predicted membrane protein	Predicted membrane protein
COG0584	Streptomyces avermitilis MA-4680 Gene: SAV_6927: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)	Streptomyces coelicolor A3(2) Gene: SCO1419: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)	Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_6113: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)	Streptomyces scabiei 87.22 Gene: SCAB_75861: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)	Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
COG2270	Streptomyces avermitilis MA-4680 Gene: SAV_6926: Permeases of the major facilitator superfamily	Streptomyces coelicolor A3(2) Gene: SCO1420: Permeases of the major facilitator superfamily	Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_6112: Permeases of the major facilitator superfamily	Streptomyces scabiei 87.22 Gene: SCAB_75851: Permeases of the major facilitator superfamily	Permeases of the major facilitator superfamily

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD