Regulon of PdxR3 in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type:	Transcription factor
TF locus tag:	SGR_6115, SGR_4328
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Pyridoxine/pyridoxal homeostasis
Effector:
Regulog:	PdxR3 - Streptomycetaceae
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By trascription factor - PdxR
By TF family - GntR/MocR
By pathway - Pyridoxine/pyridoxal homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -95 Score: 5 Sequence: AGTCCACCTTCCTCGAATTGGCCA Locus tag: SGR_6114 Name: COG2364 Funciton: Predicted membrane protein Locus tag: SGR_6113 Name: COG0584 Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) Locus tag: SGR_6112 Name: COG2270 Funciton: Permeases of the major facilitator superfamily
	SGR_6114	COG2364	Predicted membrane protein
	SGR_6113	COG0584	Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
	SGR_6112	COG2270	Permeases of the major facilitator superfamily
Position: -129 Score: 3.8 Sequence: GGACCAGCGTAGCCAATCTGGCTA Locus tag: SGR_4327 Name: COG2364 Funciton: Predicted membrane protein
	SGR_4327	COG2364	Predicted membrane protein
Position: -31 Score: 5 Sequence: TGGCCAATTCGAGGAAGGTGGACT Locus tag: SGR_6115 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	SGR_6115	pdxR3	Transcriptional regulator, GntR/MocR family
Position: -25 Score: 3.8 Sequence: TAGCCAGATTGGCTACGCTGGTCC Locus tag: SGR_4328 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	SGR_4328	pdxR3	Transcriptional regulator, GntR/MocR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD