Regulon of PdxR3 in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO1417
Regulator family:	GntR/MocR
Regulation mode:
Biological process:	Pyridoxine/pyridoxal homeostasis
Effector:
Regulog:	PdxR3 - Streptomycetaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By trascription factor - PdxR
By TF family - GntR/MocR
By pathway - Pyridoxine/pyridoxal homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 5.6 Sequence: TGGCCAATTTGGGGAAGGTGGACT Locus tag: SCO1417 Name: pdxR3 Funciton: Transcriptional regulator, GntR/MocR family
	SCO1417	pdxR3	Transcriptional regulator, GntR/MocR family
Position: -95 Score: 5.6 Sequence: AGTCCACCTTCCCCAAATTGGCCA Locus tag: SCO1418 Name: COG2364 Funciton: Predicted membrane protein Locus tag: SCO1419 Name: COG0584 Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46) Locus tag: SCO1420 Name: COG2270 Funciton: Permeases of the major facilitator superfamily
	SCO1418	COG2364	Predicted membrane protein
	SCO1419	COG0584	Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
	SCO1420	COG2270	Permeases of the major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD