Regulog BetI - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Osmotic stress response |
| Effector: | Betaine |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
- By effector - Betaine
- By pathway - Osmotic stress response
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | 5 | 1 |
| Shewanella denitrificans OS217 | 4 | 1 |
| Shewanella frigidimarina NCIMB 400 | 5 | 1 |
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | 5 | 1 |
| Shewanella halifaxensis HAW-EB4 | 5 | 1 |
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | 6 | 2 |
| Shewanella woodyi ATCC 51908 | 5 | 1 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| betT2 |
|
|
|
|
|
|
|
|
Gene: Sfri_1945: Predicted choline transporter BetT-II, BCCT family |
|
|
|
|
|
*
Shewanella sediminis HAW-EB3 Site: position = -360 score = 6.99699 sequence = TTAATTGATCGTTCAATTAA Gene: Ssed_1773: Predicted choline transporter BetT-II, BCCT family |
|
Predicted choline transporter BetT-II, BCCT family |
| CRON 2. | |||||||||||||||||
| betI |
|
|
|
|
|
|
*
Shewanella baltica OS155 Site: position = -63 score = 6.98037 sequence = TGGATTGAACGTTCAATTAA Gene: Sbal_1323: glycine betaine biosynthesis transcriptional regulator, TetR family |
*
Shewanella denitrificans OS217 Site: position = -46 score = 7.50991 sequence = TTAATTGAACGTTCAATTAA Gene: Sden_0713: glycine betaine biosynthesis transcriptional regulator, TetR family |
*
Shewanella frigidimarina NCIMB 400 Site: position = -51 score = 7.19124 sequence = TTAATTGAGCGTTCAATTAA Gene: Sfri_1948: glycine betaine biosynthesis transcriptional regulator, TetR family |
|
|
*
Shewanella pealeana ATCC 700345 Site: position = -97 score = 7.29903 sequence = TTAATTGAACGTTCAATCAA Gene: Spea_1009: glycine betaine biosynthesis transcriptional regulator, TetR family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -96 score = 7.29903 sequence = TTAATTGAACGTTCAATCAA Gene: Shal_1059: glycine betaine biosynthesis transcriptional regulator, TetR family |
|
*
Shewanella sediminis HAW-EB3 Site: position = -73 score = 7.50991 sequence = TTAATTGAACGTTCAATTAA Gene: Ssed_1121: glycine betaine biosynthesis transcriptional regulator, TetR family |
*
Shewanella woodyi ATCC 51908 Site: position = -83 score = 7.50991 sequence = TTAATTGAACGTTCAATTAA Gene: Swoo_1198: glycine betaine biosynthesis transcriptional regulator, TetR family |
glycine betaine biosynthesis transcriptional regulator, TetR family |
| betB |
|
|
|
|
|
|
Gene: Sbal_1324: Betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Sden_0714: Betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Sfri_1947: Betaine aldehyde dehydrogenase (EC 1.2.1.8) |
|
|
Gene: Spea_1008: Betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Shal_1058: Betaine aldehyde dehydrogenase (EC 1.2.1.8) |
|
Gene: Ssed_1120: Betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Gene: Swoo_1197: Betaine aldehyde dehydrogenase (EC 1.2.1.8) |
Betaine aldehyde dehydrogenase (EC 1.2.1.8) |
| betA |
|
|
|
|
|
|
Gene: Sbal_1325: Choline dehydrogenase (EC 1.1.99.1) |
Gene: Sden_0715: Choline dehydrogenase (EC 1.1.99.1) |
Gene: Sfri_1946: Choline dehydrogenase (EC 1.1.99.1) |
|
|
Gene: Spea_1007: Choline dehydrogenase (EC 1.1.99.1) |
Gene: Shal_1057: Choline dehydrogenase (EC 1.1.99.1) |
|
Gene: Ssed_1119: Choline dehydrogenase (EC 1.1.99.1) |
Gene: Swoo_1196: Choline dehydrogenase (EC 1.1.99.1) |
Choline dehydrogenase (EC 1.1.99.1) |
| betT |
|
|
|
|
|
|
Gene: Sbal_1326: Predicted choline transporter BetT, BCCT family |
Gene: Sden_0716: Predicted choline transporter BetT, BCCT family |
Gene: Sfri_1945: Predicted choline transporter BetT, BCCT family |
|
|
Gene: Spea_1006: Predicted choline transporter BetT, BCCT family |
Gene: Shal_1056: Predicted choline transporter BetT, BCCT family |
|
Gene: Ssed_1118: Predicted choline transporter BetT, BCCT family |
Gene: Swoo_1195: Predicted choline transporter BetT, BCCT family |
Predicted choline transporter BetT, BCCT family |
| Sbal_1327 |
|
|
|
|
|
|
Gene: Sbal_1327: Conserved hypothetical protein 2001 |
|
Gene: Sfri_1944: Conserved hypothetical protein 2001 |
|
|
Gene: Spea_1005: Conserved hypothetical protein 2001 |
Gene: Shal_1055: Conserved hypothetical protein 2001 |
|
Gene: Ssed_1117: Conserved hypothetical protein 2001 |
Gene: Swoo_1194: Conserved hypothetical protein 2001 |
Conserved hypothetical protein 2001 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |