Regulon of BetI in Shewanella pealeana ATCC 700345

Properties
Regulator type:	Transcription factor
TF locus tag:	Spea_1009
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Osmotic stress response
Effector:	Betaine
Regulog:	BetI - Shewanellaceae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By effector - Betaine
By pathway - Osmotic stress response

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 7.3 Sequence: TTAATTGAACGTTCAATCAA Locus tag: Spea_1009 Name: betI Funciton: glycine betaine biosynthesis transcriptional regulator, TetR family Locus tag: Spea_1008 Name: betB Funciton: Betaine aldehyde dehydrogenase (EC 1.2.1.8) Locus tag: Spea_1007 Name: betA Funciton: Choline dehydrogenase (EC 1.1.99.1) Locus tag: Spea_1006 Name: betT Funciton: Predicted choline transporter BetT, BCCT family Locus tag: Spea_1005 Name: Sbal_1327 Funciton: Conserved hypothetical protein 2001
	Spea_1009	betI	glycine betaine biosynthesis transcriptional regulator, TetR family
	Spea_1008	betB	Betaine aldehyde dehydrogenase (EC 1.2.1.8)
	Spea_1007	betA	Choline dehydrogenase (EC 1.1.99.1)
	Spea_1006	betT	Predicted choline transporter BetT, BCCT family
	Spea_1005	Sbal_1327	Conserved hypothetical protein 2001

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD