Regulon of BetI in Shewanella sediminis HAW-EB3

Properties
Regulator type:	Transcription factor
TF locus tag:	Ssed_1121
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Osmotic stress response
Effector:	Betaine
Regulog:	BetI - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By effector - Betaine
By pathway - Osmotic stress response

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 7.5 Sequence: TTAATTGAACGTTCAATTAA Locus tag: Ssed_1121 Name: betI Funciton: glycine betaine biosynthesis transcriptional regulator, TetR family Locus tag: Ssed_1120 Name: betB Funciton: Betaine aldehyde dehydrogenase (EC 1.2.1.8) Locus tag: Ssed_1119 Name: betA Funciton: Choline dehydrogenase (EC 1.1.99.1) Locus tag: Ssed_1118 Name: betT Funciton: Predicted choline transporter BetT, BCCT family Locus tag: Ssed_1117 Name: Sbal_1327 Funciton: Conserved hypothetical protein 2001
	Ssed_1121	betI	glycine betaine biosynthesis transcriptional regulator, TetR family
	Ssed_1120	betB	Betaine aldehyde dehydrogenase (EC 1.2.1.8)
	Ssed_1119	betA	Choline dehydrogenase (EC 1.1.99.1)
	Ssed_1118	betT	Predicted choline transporter BetT, BCCT family
	Ssed_1117	Sbal_1327	Conserved hypothetical protein 2001
Position: -360 Score: 7 Sequence: TTAATTGATCGTTCAATTAA Locus tag: Ssed_1773 Name: betT2 Funciton: Predicted choline transporter BetT-II, BCCT family
	Ssed_1773	betT2	Predicted choline transporter BetT-II, BCCT family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD