Regulon of BetI in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_0713
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Osmotic stress response
Effector:	Betaine
Regulog:	BetI - Shewanellaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By effector - Betaine
By pathway - Osmotic stress response

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 7.5 Sequence: TTAATTGAACGTTCAATTAA Locus tag: Sden_0713 Name: betI Funciton: glycine betaine biosynthesis transcriptional regulator, TetR family Locus tag: Sden_0714 Name: betB Funciton: Betaine aldehyde dehydrogenase (EC 1.2.1.8) Locus tag: Sden_0715 Name: betA Funciton: Choline dehydrogenase (EC 1.1.99.1) Locus tag: Sden_0716 Name: betT Funciton: Predicted choline transporter BetT, BCCT family
	Sden_0713	betI	glycine betaine biosynthesis transcriptional regulator, TetR family
	Sden_0714	betB	Betaine aldehyde dehydrogenase (EC 1.2.1.8)
	Sden_0715	betA	Choline dehydrogenase (EC 1.1.99.1)
	Sden_0716	betT	Predicted choline transporter BetT, BCCT family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD