Regulog XylR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Xylose
- By pathway - Xylose utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 6 | 3 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | 6 | 1 |
| Bradyrhizobium sp. BTAi1 | 6 | 1 |
| Brucella melitensis 16M | 11 | 3 |
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 5 | 3 |
| Rhizobium leguminosarum bv. viciae 3841 | 6 | 4 |
| Rhizobium sp. NGR234 | 3 | 1 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 3 | 1 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| xylR |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -72 score = 6.28367 sequence = TATGAGGTACGTACATCATT Gene: Atu4481: Transcriptional regulator for xylose utilization, LacI family |
|
|
*
Bradyrhizobium japonicum USDA 110 Site: position = -42 score = 5.70999 sequence = AATGAGTTGCGTACCTCAAA Gene: blr1118: Transcriptional regulator for xylose utilization, LacI family |
*
Bradyrhizobium sp. BTAi1 Site: position = -58 score = 5.14317 sequence = AATGAGTTGCGCACCTCAAA Gene: BBta_2712: Transcriptional regulator for xylose utilization, LacI family |
*
Brucella melitensis 16M Site: position = -52 score = 6.31375 sequence = TTTGATTTACGTACCTCATT Gene: BMEI1385: Transcriptional regulator for xylose utilization, LacI family |
|
|
|
*
Rhizobium etli CFN 42 Site: position = -51 score = 6.57698 sequence = TTTGATTTACGTACATCAAA Gene: RHE_CH03650: Transcriptional regulator for xylose utilization, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -48 score = 6.57698 sequence = TTTGATTTACGTACATCAAA Gene: RL4178: Transcriptional regulator for xylose utilization, LacI family |
*
Rhizobium sp. NGR234 Site: position = -53 score = 6.57698 sequence = TTTGATTTACGTACATCAAA Gene: NGR_c29500: Transcriptional regulator for xylose utilization, LacI family |
|
*
Sinorhizobium meliloti 1021 Site: position = -52 score = 6.29346 sequence = TCTGATTTACGTACATCAAA Gene: SMc03165: Transcriptional regulator for xylose utilization, LacI family |
|
Transcriptional regulator for xylose utilization, LacI family |
| xylB |
Gene: Atu4482: Xylulose kinase (EC 2.7.1.17) |
|
|
Gene: blr1119: Xylulose kinase (EC 2.7.1.17) |
Gene: BBta_2713: Xylulose kinase (EC 2.7.1.17) |
Gene: BMEI1386: Xylulose kinase (EC 2.7.1.17) |
Gene: mlr5033: Xylulose kinase (EC 2.7.1.17) |
Gene: Meso_2819: Xylulose kinase (EC 2.7.1.17) |
|
Gene: RHE_CH03649: Xylulose kinase (EC 2.7.1.17) |
Gene: RL4177: Xylulose kinase (EC 2.7.1.17) |
Gene: NGR_c29490: Xylulose kinase (EC 2.7.1.17) |
|
Gene: SMc03164: Xylulose kinase (EC 2.7.1.17) |
|
Xylulose kinase (EC 2.7.1.17) |
| xylA |
Gene: Atu4483: Xylose isomerase (EC 5.3.1.5) |
|
|
Gene: blr1120: Xylose isomerase (EC 5.3.1.5) |
Gene: BBta_2714: Xylose isomerase (EC 5.3.1.5) |
Gene: BMEI1387: Xylose isomerase (EC 5.3.1.5) |
Gene: mlr5036: Xylose isomerase (EC 5.3.1.5) |
Gene: Meso_2820: Xylose isomerase (EC 5.3.1.5) |
|
Gene: RHE_CH03648: Xylose isomerase (EC 5.3.1.5) |
Gene: RL4176: Xylose isomerase (EC 5.3.1.5) |
Gene: NGR_c29480: Xylose isomerase (EC 5.3.1.5) |
|
Gene: SMc03163: Xylose isomerase (EC 5.3.1.5) |
|
Xylose isomerase (EC 5.3.1.5) |
| xylG |
|
|
|
Gene: blr1121: Xylose ABC transporter, ATP-binding protein XylG |
Gene: BBta_2715: Xylose ABC transporter, ATP-binding protein XylG |
|
|
|
|
|
|
|
|
|
|
Xylose ABC transporter, ATP-binding protein XylG |
| xylH |
|
|
|
Gene: blr1122: Xylose ABC transporter, permease protein XylH |
Gene: BBta_2716: Xylose ABC transporter, permease protein XylH |
|
|
|
|
|
|
|
|
|
|
Xylose ABC transporter, permease protein XylH |
| xylF |
|
|
|
Gene: blr1123: Xylose ABC transporter, periplasmic xylose-binding protein XylF |
Gene: BBta_2717: Xylose ABC transporter, periplasmic xylose-binding protein XylF |
|
|
|
|
|
|
|
|
|
|
Xylose ABC transporter, periplasmic xylose-binding protein XylF |
| CRON 2. | ||||||||||||||||
| xynA |
|
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -41 score = 6.3869 sequence = TTTGATGTACGTACCTCAAC Gene: RHE_CH02453: Beta-xylosidase (EC 3.2.1.37) |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -50 score = 6.00309 sequence = TGTGATGTACGTACAGCAAA Gene: RL2788: Beta-xylosidase (EC 3.2.1.37) |
Gene: NGR_c17670: Beta-xylosidase (EC 3.2.1.37) |
|
Gene: SMc04247: Beta-xylosidase (EC 3.2.1.37) |
|
Beta-xylosidase (EC 3.2.1.37) |
| CRON 3. | ||||||||||||||||
| COG5001 |
|
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -63 score = 5.8848 sequence = TTTGAGGTACGTCCATCAGA Gene: RHE_CH01398: Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -72 score = 5.20507 sequence = AATGATGCACGTACGTCAGT Gene: RL1519: Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain |
|
|
|
|
Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain |
| CRON 4. | ||||||||||||||||
| COG3576 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -104 score = 6.49928 sequence = TTTGAGGTACGTACCTCAAT Gene: Atu4480: Predicted flavin-nucleotide-binding protein structurally related to pyridoxine 5'-phosphate oxidase |
|
|
|
|
|
|
|
|
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -115 score = 6.22643 sequence = TCTGAGGTACGTACATCATA Gene: RL1181: Predicted flavin-nucleotide-binding protein structurally related to pyridoxine 5'-phosphate oxidase |
|
|
|
|
Predicted flavin-nucleotide-binding protein structurally related to pyridoxine 5'-phosphate oxidase |
| CRON 5. | ||||||||||||||||
| Atu3200 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -129 score = 6.18194 sequence = ATTGCTTTACGTACCTCAAA Gene: Atu3200: ABC transporter, nucleotide binding/ATPase protein (ribose) |
|
|
|
|
*
Brucella melitensis 16M Site: position = -102 score = 6.03262 sequence = TTTGCTTTACGTACCTCAAC Gene: BMEI1392: ABC transporter, nucleotide binding/ATPase protein (ribose) |
|
|
|
|
|
|
|
|
|
ABC transporter, nucleotide binding/ATPase protein (ribose) |
| Atu3199 |
Gene: Atu3199: ABC transporter, membrane spanning protein |
|
|
|
|
Gene: BMEI1391: ABC transporter, membrane spanning protein |
|
|
|
|
|
|
|
|
|
ABC transporter, membrane spanning protein |
| Atu3198 |
Gene: Atu3198: ABC transporter, substrate binding protein |
|
|
|
|
Gene: BMEI1390: ABC transporter, substrate binding protein |
|
|
|
|
|
|
|
|
|
ABC transporter, substrate binding protein |
| Atu3235 |
|
|
|
|
|
Gene: BMEI1389: Sugar phosphate isomerases/epimerases |
|
|
|
|
|
|
|
|
|
Sugar phosphate isomerases/epimerases |
| Atu4375 |
|
|
|
|
|
Gene: BMEI1388: Oxidoreductase, Gfo/Idh/MocA family |
|
|
|
|
|
|
|
|
|
Oxidoreductase, Gfo/Idh/MocA family |
| CRON 6. | ||||||||||||||||
| xylF2 |
|
|
|
|
|
*
Brucella melitensis 16M Site: position = -320 score = 6.31375 sequence = AATGAGGTACGTAAATCAAA Gene: BMEII0146: Xylose ABC transporter, periplasmic xylose-binding protein XylF |
|
|
|
|
|
|
|
|
|
Xylose ABC transporter, periplasmic xylose-binding protein XylF |
| xylG2 |
|
|
|
|
|
Gene: BMEII0145: Xylose ABC transporter, ATP-binding protein XylG |
|
|
|
|
|
|
|
|
|
Xylose ABC transporter, ATP-binding protein XylG |
| xylH2 |
|
|
|
|
|
Gene: BMEII0144: Xylose ABC transporter, permease protein XylH |
|
|
|
|
|
|
|
|
|
Xylose ABC transporter, permease protein XylH |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |