Regulon of XylR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL4178
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.2 Sequence: AATGATGCACGTACGTCAGT Locus tag: RL1519 Name: COG5001 Funciton: Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain
	RL1519	COG5001	Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain
Position: -50 Score: 6 Sequence: TGTGATGTACGTACAGCAAA Locus tag: RL2788 Name: xynA Funciton: Beta-xylosidase (EC 3.2.1.37)
	RL2788	xynA	Beta-xylosidase (EC 3.2.1.37)
Position: -115 Score: 6.2 Sequence: TCTGAGGTACGTACATCATA Locus tag: RL1181 Name: COG3576 Funciton: Predicted flavin-nucleotide-binding protein structurally related to pyridoxine 5'-phosphate oxidase
	RL1181	COG3576	Predicted flavin-nucleotide-binding protein structurally related to pyridoxine 5'-phosphate oxidase
Position: -48 Score: 6.6 Sequence: TTTGATTTACGTACATCAAA Locus tag: RL4178 Name: xylR Funciton: Transcriptional regulator for xylose utilization, LacI family Locus tag: RL4177 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: RL4176 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5)
	RL4178	xylR	Transcriptional regulator for xylose utilization, LacI family
	RL4177	xylB	Xylulose kinase (EC 2.7.1.17)
	RL4176	xylA	Xylose isomerase (EC 5.3.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD