Regulon of XylR in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH03650
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 6.4 Sequence: TTTGATGTACGTACCTCAAC Locus tag: RHE_CH02453 Name: xynA Funciton: Beta-xylosidase (EC 3.2.1.37)
	RHE_CH02453	xynA	Beta-xylosidase (EC 3.2.1.37)
Position: -63 Score: 5.9 Sequence: TTTGAGGTACGTCCATCAGA Locus tag: RHE_CH01398 Name: COG5001 Funciton: Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain
	RHE_CH01398	COG5001	Predicted signal transduction protein containing a membrane domain, an EAL and a GGDEF domain
Position: -51 Score: 6.6 Sequence: TTTGATTTACGTACATCAAA Locus tag: RHE_CH03650 Name: xylR Funciton: Transcriptional regulator for xylose utilization, LacI family Locus tag: RHE_CH03649 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: RHE_CH03648 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5)
	RHE_CH03650	xylR	Transcriptional regulator for xylose utilization, LacI family
	RHE_CH03649	xylB	Xylulose kinase (EC 2.7.1.17)
	RHE_CH03648	xylA	Xylose isomerase (EC 5.3.1.5)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD