Regulog BglR - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside; Glucose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By TF family - LacI
- By effector - Beta-glucoside
- By effector - Glucose
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | ||
| Erythrobacter sp. NAP1 | 4 | 1 |
| Novosphingobium aromaticivorans DSM 12444 | 9 | 2 |
| Sphingobium japonicum UT26S | ||
| Sphingomonas wittichii RW1 | ||
| Sphingopyxis alaskensis RB2256 | 9 | 2 |
| Zymomonas mobilis subsp. mobilis ZM4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| bglX |
|
|
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -34 score = 5.92646 sequence = GTTTGAGAACGTTCACAGAA Gene: Saro_1611: Beta-glucosidase (EC 3.2.1.21) |
|
|
*
Sphingopyxis alaskensis RB2256 Site: position = -35 score = 5.97983 sequence = AAATGAGAACGTTCACAAGA Gene: Sala_1511: Beta-glucosidase (EC 3.2.1.21) |
|
Beta-glucosidase (EC 3.2.1.21) |
| CRON 2. | ||||||||
| omp(Bgl) |
|
*
Erythrobacter sp. NAP1 Site: position = -92 score = 4.96037 sequence = CCTTGTGAACGCTAACAAAA Gene: NAP1_09747: TonB-dependent outer membrane transporter for beta-glucosides |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -78 score = 5.72672 sequence = CTGCGTGAACGTTCTCATAT Site: position = -60 score = 5.98533 sequence = ATAGGTGAACGTTCACAACA Gene: Saro_1603: TonB-dependent outer membrane transporter for beta-glucosides |
|
|
*
Sphingopyxis alaskensis RB2256 Site: position = -84 score = 5.29717 sequence = CGAAGTGAACGTTATCATTT Site: position = -66 score = 6.04402 sequence = TTACGTGAACGTTCACAATC Gene: Sala_0914: TonB-dependent outer membrane transporter for beta-glucosides |
|
TonB-dependent outer membrane transporter for beta-glucosides |
| thl1 |
|
|
Gene: Saro_1604: tryptophan halogenase, putative |
|
|
Gene: Sala_0915: tryptophan halogenase, putative |
|
tryptophan halogenase, putative |
| sapC |
|
|
Gene: Saro_1605: Peptide transport system permease protein sapC (TC 3.A.1.5.5) |
|
|
Gene: Sala_0916: Peptide transport system permease protein sapC (TC 3.A.1.5.5) |
|
Peptide transport system permease protein sapC (TC 3.A.1.5.5) |
| Sala_0917 |
|
|
Gene: Saro_1606: Pass1-related protein |
|
|
Gene: Sala_0917: Pass1-related protein |
|
Pass1-related protein |
| thl2 |
|
|
Gene: Saro_1607: tryptophan halogenase, putative |
|
|
Gene: Sala_0918: tryptophan halogenase, putative |
|
tryptophan halogenase, putative |
| bglA |
|
Gene: NAP1_09742: Glucan endo-1,3-beta-D-glucosidase |
Gene: Saro_1608: Glucan endo-1,3-beta-D-glucosidase |
|
|
Gene: Sala_0919: Glucan endo-1,3-beta-D-glucosidase |
|
Glucan endo-1,3-beta-D-glucosidase |
| bglR |
|
Gene: NAP1_09737: Transcriptional regulator of beta-glucoside utilization, LacI family |
Gene: Saro_1609: Transcriptional regulator of beta-glucoside utilization, LacI family |
|
|
Gene: Sala_0920: Transcriptional regulator of beta-glucoside utilization, LacI family |
|
Transcriptional regulator of beta-glucoside utilization, LacI family |
| bglT |
|
Gene: NAP1_09732: Putative beta-glucoside permease, MFS superfamily |
Gene: Saro_1610: Putative beta-glucoside permease, MFS superfamily |
|
|
Gene: Sala_0921: Putative beta-glucoside permease, MFS superfamily |
|
Putative beta-glucoside permease, MFS superfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |