Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing omp(Bgl) gene

Properties
Regulog: BglR - Sphingomonadales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Phylum: Proteobacteria/Alpha
Built upon 7 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Erythrobacter sp. NAP1
Position: -92
Score: 4.96037
Sequence: CCTTGTGAACGCTAACAAAA
Locus tag: NAP1_09747
Name: omp(Bgl)
Funciton: TonB-dependent outer membrane transporter for beta-glucosides
Locus tag: NAP1_09742
Name: bglA
Funciton: Glucan endo-1,3-beta-D-glucosidase
Locus tag: NAP1_09737
Name: bglR
Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family
Locus tag: NAP1_09732
Name: bglT
Funciton: Putative beta-glucoside permease, MFS superfamily
omp(Bgl)-bglA-bglR-bglT -92 5 CCTTGTGAACGCTAACAAAA NAP1_09747
Novosphingobium aromaticivorans DSM 12444
Position: -78
Score: 5.72672
Sequence: CTGCGTGAACGTTCTCATAT
Position: -60
Score: 5.98533
Sequence: ATAGGTGAACGTTCACAACA
Locus tag: Saro_1603
Name: omp(Bgl)
Funciton: TonB-dependent outer membrane transporter for beta-glucosides
Locus tag: Saro_1604
Name: thl1
Funciton: tryptophan halogenase, putative
Locus tag: Saro_1605
Name: sapC
Funciton: Peptide transport system permease protein sapC (TC 3.A.1.5.5)
Locus tag: Saro_1606
Name: Sala_0917
Funciton: Pass1-related protein
Locus tag: Saro_1607
Name: thl2
Funciton: tryptophan halogenase, putative
Locus tag: Saro_1608
Name: bglA
Funciton: Glucan endo-1,3-beta-D-glucosidase
Locus tag: Saro_1609
Name: bglR
Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family
Locus tag: Saro_1610
Name: bglT
Funciton: Putative beta-glucoside permease, MFS superfamily
omp(Bgl)-thl1-sapC-Sala_0917-thl2-bglA-bglR-bglT -78 5.7 CTGCGTGAACGTTCTCATAT Saro_1603
-60 6 ATAGGTGAACGTTCACAACA
Sphingopyxis alaskensis RB2256
Position: -84
Score: 5.29717
Sequence: CGAAGTGAACGTTATCATTT
Position: -66
Score: 6.04402
Sequence: TTACGTGAACGTTCACAATC
Locus tag: Sala_0914
Name: omp(Bgl)
Funciton: TonB-dependent outer membrane transporter for beta-glucosides
Locus tag: Sala_0915
Name: thl1
Funciton: tryptophan halogenase, putative
Locus tag: Sala_0916
Name: sapC
Funciton: Peptide transport system permease protein sapC (TC 3.A.1.5.5)
Locus tag: Sala_0917
Name: Sala_0917
Funciton: Pass1-related protein
Locus tag: Sala_0918
Name: thl2
Funciton: tryptophan halogenase, putative
Locus tag: Sala_0919
Name: bglA
Funciton: Glucan endo-1,3-beta-D-glucosidase
Locus tag: Sala_0920
Name: bglR
Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family
Locus tag: Sala_0921
Name: bglT
Funciton: Putative beta-glucoside permease, MFS superfamily
omp(Bgl)-thl1-sapC-Sala_0917-thl2-bglA-bglR-bglT -84 5.3 CGAAGTGAACGTTATCATTT Sala_0914
-66 6 TTACGTGAACGTTCACAATC