Orthologous regulated operons containing omp(Bgl) gene

Properties
Regulog:	BglR - Sphingomonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Phylum:	Proteobacteria/Alpha

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Erythrobacter sp. NAP1
Position: -92 Score: 4.96037 Sequence: CCTTGTGAACGCTAACAAAA Locus tag: NAP1_09747 Name: omp(Bgl) Funciton: TonB-dependent outer membrane transporter for beta-glucosides Locus tag: NAP1_09742 Name: bglA Funciton: Glucan endo-1,3-beta-D-glucosidase Locus tag: NAP1_09737 Name: bglR Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family Locus tag: NAP1_09732 Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily
omp(Bgl)-bglA-bglR-bglT	-92	5	CCTTGTGAACGCTAACAAAA	NAP1_09747
Novosphingobium aromaticivorans DSM 12444
Position: -78 Score: 5.72672 Sequence: CTGCGTGAACGTTCTCATAT Position: -60 Score: 5.98533 Sequence: ATAGGTGAACGTTCACAACA Locus tag: Saro_1603 Name: omp(Bgl) Funciton: TonB-dependent outer membrane transporter for beta-glucosides Locus tag: Saro_1604 Name: thl1 Funciton: tryptophan halogenase, putative Locus tag: Saro_1605 Name: sapC Funciton: Peptide transport system permease protein sapC (TC 3.A.1.5.5) Locus tag: Saro_1606 Name: Sala_0917 Funciton: Pass1-related protein Locus tag: Saro_1607 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: Saro_1608 Name: bglA Funciton: Glucan endo-1,3-beta-D-glucosidase Locus tag: Saro_1609 Name: bglR Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family Locus tag: Saro_1610 Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily
omp(Bgl)-thl1-sapC-Sala_0917-thl2-bglA-bglR-bglT	-78	5.7	CTGCGTGAACGTTCTCATAT	Saro_1603
	-60	6	ATAGGTGAACGTTCACAACA
Sphingopyxis alaskensis RB2256
Position: -84 Score: 5.29717 Sequence: CGAAGTGAACGTTATCATTT Position: -66 Score: 6.04402 Sequence: TTACGTGAACGTTCACAATC Locus tag: Sala_0914 Name: omp(Bgl) Funciton: TonB-dependent outer membrane transporter for beta-glucosides Locus tag: Sala_0915 Name: thl1 Funciton: tryptophan halogenase, putative Locus tag: Sala_0916 Name: sapC Funciton: Peptide transport system permease protein sapC (TC 3.A.1.5.5) Locus tag: Sala_0917 Name: Sala_0917 Funciton: Pass1-related protein Locus tag: Sala_0918 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: Sala_0919 Name: bglA Funciton: Glucan endo-1,3-beta-D-glucosidase Locus tag: Sala_0920 Name: bglR Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family Locus tag: Sala_0921 Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily
omp(Bgl)-thl1-sapC-Sala_0917-thl2-bglA-bglR-bglT	-84	5.3	CGAAGTGAACGTTATCATTT	Sala_0914
	-66	6	TTACGTGAACGTTCACAATC