Regulon of BglR in Erythrobacter sp. NAP1

Properties
Regulator type:	Transcription factor
TF locus tag:	NAP1_09737
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR - Sphingomonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 5 Sequence: CCTTGTGAACGCTAACAAAA Locus tag: NAP1_09747 Name: omp(Bgl) Funciton: TonB-dependent outer membrane transporter for beta-glucosides Locus tag: NAP1_09742 Name: bglA Funciton: Glucan endo-1,3-beta-D-glucosidase Locus tag: NAP1_09737 Name: bglR Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family Locus tag: NAP1_09732 Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily
	NAP1_09747	omp(Bgl)	TonB-dependent outer membrane transporter for beta-glucosides
	NAP1_09742	bglA	Glucan endo-1,3-beta-D-glucosidase
	NAP1_09737	bglR	Transcriptional regulator of beta-glucoside utilization, LacI family
	NAP1_09732	bglT	Putative beta-glucoside permease, MFS superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD