Regulon of BglR in Novosphingobium aromaticivorans DSM 12444

Properties
Regulator type:	Transcription factor
TF locus tag:	Saro_1609
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR - Sphingomonadales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 5.9 Sequence: GTTTGAGAACGTTCACAGAA Locus tag: Saro_1611 Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
	Saro_1611	bglX	Beta-glucosidase (EC 3.2.1.21)
Position: -78 Score: 5.7 Sequence: CTGCGTGAACGTTCTCATAT Position: -60 Score: 6 Sequence: ATAGGTGAACGTTCACAACA Locus tag: Saro_1603 Name: omp(Bgl) Funciton: TonB-dependent outer membrane transporter for beta-glucosides Locus tag: Saro_1604 Name: thl1 Funciton: tryptophan halogenase, putative Locus tag: Saro_1605 Name: sapC Funciton: Peptide transport system permease protein sapC (TC 3.A.1.5.5) Locus tag: Saro_1606 Name: Sala_0917 Funciton: Pass1-related protein Locus tag: Saro_1607 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: Saro_1608 Name: bglA Funciton: Glucan endo-1,3-beta-D-glucosidase Locus tag: Saro_1609 Name: bglR Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family Locus tag: Saro_1610 Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily
	Saro_1603	omp(Bgl)	TonB-dependent outer membrane transporter for beta-glucosides
	Saro_1604	thl1	tryptophan halogenase, putative
	Saro_1605	sapC	Peptide transport system permease protein sapC (TC 3.A.1.5.5)
	Saro_1606	Sala_0917	Pass1-related protein
	Saro_1607	thl2	tryptophan halogenase, putative
	Saro_1608	bglA	Glucan endo-1,3-beta-D-glucosidase
	Saro_1609	bglR	Transcriptional regulator of beta-glucoside utilization, LacI family
	Saro_1610	bglT	Putative beta-glucoside permease, MFS superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD