Regulon of BglR in Sphingopyxis alaskensis RB2256

Properties
Regulator type:	Transcription factor
TF locus tag:	Sala_0920
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR - Sphingomonadales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6 Sequence: AAATGAGAACGTTCACAAGA Locus tag: Sala_1511 Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
	Sala_1511	bglX	Beta-glucosidase (EC 3.2.1.21)
Position: -84 Score: 5.3 Sequence: CGAAGTGAACGTTATCATTT Position: -66 Score: 6 Sequence: TTACGTGAACGTTCACAATC Locus tag: Sala_0914 Name: omp(Bgl) Funciton: TonB-dependent outer membrane transporter for beta-glucosides Locus tag: Sala_0915 Name: thl1 Funciton: tryptophan halogenase, putative Locus tag: Sala_0916 Name: sapC Funciton: Peptide transport system permease protein sapC (TC 3.A.1.5.5) Locus tag: Sala_0917 Name: Sala_0917 Funciton: Pass1-related protein Locus tag: Sala_0918 Name: thl2 Funciton: tryptophan halogenase, putative Locus tag: Sala_0919 Name: bglA Funciton: Glucan endo-1,3-beta-D-glucosidase Locus tag: Sala_0920 Name: bglR Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family Locus tag: Sala_0921 Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily
	Sala_0914	omp(Bgl)	TonB-dependent outer membrane transporter for beta-glucosides
	Sala_0915	thl1	tryptophan halogenase, putative
	Sala_0916	sapC	Peptide transport system permease protein sapC (TC 3.A.1.5.5)
	Sala_0917	Sala_0917	Pass1-related protein
	Sala_0918	thl2	tryptophan halogenase, putative
	Sala_0919	bglA	Glucan endo-1,3-beta-D-glucosidase
	Sala_0920	bglR	Transcriptional regulator of beta-glucoside utilization, LacI family
	Sala_0921	bglT	Putative beta-glucoside permease, MFS superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD