Regulog Jann_1107 - Rhodobacterales

Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By pathway - Sugar utilization
Genome | Genes | Operons |
---|---|---|
Hyphomonas neptunium ATCC 15444 | ||
Jannaschia sp. CCS1 | 18 | 4 |
Loktanella vestfoldensis SKA53 | ||
Oceanicaulis alexandrii HTCC2633 | ||
Oceanicola batsensis HTCC2597 | ||
Oceanicola granulosus HTCC2516 | 10 | 1 |
Paracoccus denitrificans PD1222 | ||
Rhodobacter sphaeroides 2.4.1 | ||
Rhodobacterales bacterium HTCC2654 | ||
Roseobacter sp. MED193 | ||
Roseovarius nubinhibens ISM | ||
Roseovarius sp. 217 | ||
Silicibacter TM1040 | ||
Silicibacter pomeroyi DSS-3 | ||
Sulfitobacter sp. EE-36 |
Genes | Function | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||||||
Jann_2640 |
|
*
Jannaschia sp. CCS1 Site: position = -86 score = 6.61837 sequence = TTTTGCAAACCTATGCAAAA Gene: Jann_2640: Sugar ABC transporter, ATP-binding protein |
|
|
|
*
Oceanicola granulosus HTCC2516 Site: position = -50 score = 4.95742 sequence = CCTTGCAAGCGCATGCAAGG Gene: OG2516_10551: Sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, ATP-binding protein |
Jann_3701 |
|
*
Jannaschia sp. CCS1 Site: position = -36 score = 6.36128 sequence = TCTTGCAAACCTATGCAAAA Gene: Jann_3701: Sugar ABC transporter, substrate-binding protein |
|
|
|
Gene: OG2516_10546: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, substrate-binding protein |
Jann_3700 |
|
Gene: Jann_3700: Sugar ABC transporter, inner membrane protein |
|
|
|
Gene: OG2516_10541: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, inner membrane protein |
Jann_3699 |
|
Gene: Jann_3699: Sugar ABC transporter, inner membrane protein |
|
|
|
Gene: OG2516_10536: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, inner membrane protein |
PF03766 |
|
Gene: Jann_2638: Protein of unknown function DUF1486 |
|
|
|
Gene: OG2516_10531: Protein of unknown function DUF1486 |
|
|
|
|
|
|
|
|
|
Protein of unknown function DUF1486 |
PF00815 |
|
*
Jannaschia sp. CCS1 Site: position = -81 score = 5.9338 sequence = TTTTGCAATCGTATGCAGAT Gene: Jann_1104: Histidinol dehydrogenase |
|
|
|
Gene: OG2516_10526: Histidinol dehydrogenase |
|
|
|
|
|
|
|
|
|
Histidinol dehydrogenase |
PF07366-3 |
|
Gene: Jann_1105: Protein of unknown function DUF1486 |
|
|
|
Gene: OG2516_10521: Protein of unknown function DUF1486 |
|
|
|
|
|
|
|
|
|
Protein of unknown function DUF1486 |
COG1028 |
|
Gene: Jann_1106: short-chain dehydrogenase/reductase SDR |
|
|
|
Gene: OG2516_10516: short-chain dehydrogenase/reductase SDR |
|
|
|
|
|
|
|
|
|
short-chain dehydrogenase/reductase SDR |
Jann_1107 |
|
Gene: Jann_1107: Transcriptional regulator, LacI family |
|
|
|
Gene: OG2516_10511: Transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
|
Transcriptional regulator, LacI family |
PF07366-2 |
|
Gene: Jann_1108: Protein of unknown function DUF1486 |
|
|
|
Gene: OG2516_10506: Protein of unknown function DUF1486 |
|
|
|
|
|
|
|
|
|
Protein of unknown function DUF1486 |
Jann_4090 |
|
*
Jannaschia sp. CCS1 Site: position = -93 score = 5.72872 sequence = GGGTGCATACGAATGCAAAA Gene: Jann_4090: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, substrate-binding protein |
Jann_4089 |
|
Gene: Jann_4089: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, inner membrane protein |
Jann_4088 |
|
Gene: Jann_4088: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, inner membrane protein |
Jann_4087 |
|
Gene: Jann_4087: Sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, ATP-binding protein |
Jann_4086 |
|
Gene: Jann_4086: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
Jann_4085 |
|
Gene: Jann_4085: Cupin 2 protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Cupin 2 protein |
Jann_4084 |
|
Gene: Jann_4084: acyl transferase |
|
|
|
|
|
|
|
|
|
|
|
|
|
acyl transferase |
Jann_2639 |
|
Gene: Jann_2639: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |