Profile of regulator Jann_1107 in Rhodobacterales

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Jann_1107 - Rhodobacterales

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Jannaschia sp. CCS1
	Jann_4090	null	-93	5.7	GGGTGCATACGAATGCAAAA
	Jann_3701	Jann_3701	-36	6.4	TCTTGCAAACCTATGCAAAA
	Jann_2640	Jann_2640	-86	6.6	TTTTGCAAACCTATGCAAAA
	Jann_1104	PF00815	-81	5.9	TTTTGCAATCGTATGCAGAT
Oceanicola granulosus HTCC2516
	OG2516_10551	Jann_2640	-50	5	CCTTGCAAGCGCATGCAAGG

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD