Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Jann_2639 gene

Properties
Regulog: Jann_1107 - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Phylum: Proteobacteria/Alpha
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -86
Score: 6.61837
Sequence: TTTTGCAAACCTATGCAAAA
Locus tag: Jann_2640
Name: Jann_2640
Funciton: Sugar ABC transporter, ATP-binding protein
Locus tag: Jann_2639
Name: null
Funciton: hypothetical protein
Locus tag: Jann_2638
Name: PF03766
Funciton: Protein of unknown function DUF1486
Jann_2640-Jann_2639-PF03766 -86 6.6 TTTTGCAAACCTATGCAAAA Jann_2640
© 2009-2020 RegPrecise