Regulon of Jann_1107 in Oceanicola granulosus HTCC2516

Properties
Regulator type:	Transcription factor
TF locus tag:	OG2516_10511
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Jann_1107 - Rhodobacterales
Statistics of regulated genes:
- Genes	10
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 5 Sequence: CCTTGCAAGCGCATGCAAGG Locus tag: OG2516_10551 Name: Jann_2640 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: OG2516_10546 Name: Jann_3701 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: OG2516_10541 Name: Jann_3700 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: OG2516_10536 Name: Jann_3699 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: OG2516_10531 Name: PF03766 Funciton: Protein of unknown function DUF1486 Locus tag: OG2516_10526 Name: PF00815 Funciton: Histidinol dehydrogenase Locus tag: OG2516_10521 Name: PF07366-3 Funciton: Protein of unknown function DUF1486 Locus tag: OG2516_10516 Name: COG1028 Funciton: short-chain dehydrogenase/reductase SDR Locus tag: OG2516_10511 Name: Jann_1107 Funciton: Transcriptional regulator, LacI family Locus tag: OG2516_10506 Name: PF07366-2 Funciton: Protein of unknown function DUF1486
	OG2516_10551	Jann_2640	Sugar ABC transporter, ATP-binding protein
	OG2516_10546	Jann_3701	Sugar ABC transporter, substrate-binding protein
	OG2516_10541	Jann_3700	Sugar ABC transporter, inner membrane protein
	OG2516_10536	Jann_3699	Sugar ABC transporter, inner membrane protein
	OG2516_10531	PF03766	Protein of unknown function DUF1486
	OG2516_10526	PF00815	Histidinol dehydrogenase
	OG2516_10521	PF07366-3	Protein of unknown function DUF1486
	OG2516_10516	COG1028	short-chain dehydrogenase/reductase SDR
	OG2516_10511	Jann_1107	Transcriptional regulator, LacI family
	OG2516_10506	PF07366-2	Protein of unknown function DUF1486

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD