Regulon of Jann_1107 in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_1107
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Jann_1107 - Rhodobacterales
Statistics of regulated genes:
- Genes	18
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -93 Score: 5.7 Sequence: GGGTGCATACGAATGCAAAA Locus tag: Jann_4090 Name: null Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Jann_4089 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Jann_4088 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Jann_4087 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Jann_4086 Name: null Funciton: hypothetical protein Locus tag: Jann_4085 Name: null Funciton: Cupin 2 protein Locus tag: Jann_4084 Name: null Funciton: acyl transferase
	Jann_4090		Sugar ABC transporter, substrate-binding protein
	Jann_4089		Sugar ABC transporter, inner membrane protein
	Jann_4088		Sugar ABC transporter, inner membrane protein
	Jann_4087		Sugar ABC transporter, ATP-binding protein
	Jann_4086		hypothetical protein
	Jann_4085		Cupin 2 protein
	Jann_4084		acyl transferase
Position: -36 Score: 6.4 Sequence: TCTTGCAAACCTATGCAAAA Locus tag: Jann_3701 Name: Jann_3701 Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Jann_3700 Name: Jann_3700 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Jann_3699 Name: Jann_3699 Funciton: Sugar ABC transporter, inner membrane protein
	Jann_3701	Jann_3701	Sugar ABC transporter, substrate-binding protein
	Jann_3700	Jann_3700	Sugar ABC transporter, inner membrane protein
	Jann_3699	Jann_3699	Sugar ABC transporter, inner membrane protein
Position: -81 Score: 5.9 Sequence: TTTTGCAATCGTATGCAGAT Locus tag: Jann_1104 Name: PF00815 Funciton: Histidinol dehydrogenase Locus tag: Jann_1105 Name: PF07366-3 Funciton: Protein of unknown function DUF1486 Locus tag: Jann_1106 Name: COG1028 Funciton: short-chain dehydrogenase/reductase SDR Locus tag: Jann_1107 Name: Jann_1107 Funciton: Transcriptional regulator, LacI family Locus tag: Jann_1108 Name: PF07366-2 Funciton: Protein of unknown function DUF1486
	Jann_1104	PF00815	Histidinol dehydrogenase
	Jann_1105	PF07366-3	Protein of unknown function DUF1486
	Jann_1106	COG1028	short-chain dehydrogenase/reductase SDR
	Jann_1107	Jann_1107	Transcriptional regulator, LacI family
	Jann_1108	PF07366-2	Protein of unknown function DUF1486
Position: -86 Score: 6.6 Sequence: TTTTGCAAACCTATGCAAAA Locus tag: Jann_2640 Name: Jann_2640 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Jann_2639 Name: null Funciton: hypothetical protein Locus tag: Jann_2638 Name: PF03766 Funciton: Protein of unknown function DUF1486
	Jann_2640	Jann_2640	Sugar ABC transporter, ATP-binding protein
	Jann_2639		hypothetical protein
	Jann_2638	PF03766	Protein of unknown function DUF1486

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Jann_1107 in Jannaschia sp. CCS1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --