Regulog VCA0673 - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | ||
| Vibrio angustum S14 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 | 5 | 3 |
| Vibrio fischeri ES114 | ||
| Vibrio harveyi ATCC BAA-1116 | 6 | 3 |
| Vibrio parahaemolyticus RIMD 2210633 | ||
| Vibrio salmonicida LFI1238 | 3 | 1 |
| Vibrio shilonii AK1 | 2 | 1 |
| Vibrio splendidus LGP32 | ||
| Vibrio vulnificus CMCP6 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| VCA0669 |
|
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -163 score = 6.43331 sequence = AAATGGGTACGCATTCATTT Gene: VCA0669: MFS transporter |
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -163 score = 6.28052 sequence = TAATGGGTACGCATTCATTT Site: position = -295 score = 5.16488 sequence = ACTTGAGTACGTAACCATTT Gene: VIBHAR_04815: MFS transporter |
|
*
Vibrio salmonicida LFI1238 Site: position = -153 score = 6.55511 sequence = AAATGGGTACGCACCCATTT Gene: VSAL_I2463: MFS transporter |
Gene: VSAK1_07079: MFS transporter |
|
|
MFS transporter |
| VCA0671 |
|
|
Gene: VCA0671: hypothetical protein |
|
Gene: VIBHAR_04814: hypothetical protein |
|
Gene: VSAL_I2464: hypothetical protein |
Gene: VSAK1_07074: hypothetical protein |
|
|
hypothetical protein |
| VCA0673 |
|
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -43 score = 5.22743 sequence = TGATGACTACGTAACTATTT Gene: VCA0673: Transcriptional regulator, LacI family |
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -64 score = 5.61653 sequence = TTATGACTACGTACCTATTT Gene: VIBHAR_04812: Transcriptional regulator, LacI family |
|
Gene: VSAL_I2465: Transcriptional regulator, LacI family |
*2
Vibrio shilonii AK1 Site: position = -64 score = 5.4273 sequence = TTATGCATACGTACCAATTT Gene: VSAK1_07064: Transcriptional regulator, LacI family Gene: VSAK1_07059: Transcriptional regulator, LacI family |
|
|
Transcriptional regulator, LacI family |
| VIBHAR_04813 |
|
|
|
|
Gene: VIBHAR_04813: outer membrane porin, putative |
|
|
Gene: VSAK1_07069: outer membrane porin, putative |
|
|
outer membrane porin, putative |
| CRON 2. | |||||||||||
| VCA0667 |
|
|
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -195 score = 6.43331 sequence = AAATGAATGCGTACCCATTT Gene: VCA0667: sodium-solute symporter, putative |
|
*
Vibrio harveyi ATCC BAA-1116 Site: position = -134 score = 6.28052 sequence = AAATGAATGCGTACCCATTA Gene: VIBHAR_04816: sodium-solute symporter, putative |
|
|
Gene: VSAK1_07084: sodium-solute symporter, putative |
|
|
sodium-solute symporter, putative |
| sds |
|
|
Gene: VCA0666: L-serine dehydratase (EC 4.3.1.17) |
|
Gene: VIBHAR_04817: L-serine dehydratase (EC 4.3.1.17) |
|
|
Gene: VSAK1_07089: L-serine dehydratase (EC 4.3.1.17) |
|
|
L-serine dehydratase (EC 4.3.1.17) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |