Regulon of VCA0673 in Vibrio salmonicida LFI1238

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAL_I2465
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	VCA0673 - Vibrionales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 6.6 Sequence: AAATGGGTACGCACCCATTT Locus tag: VSAL_I2463 Name: null Funciton: MFS transporter Locus tag: VSAL_I2464 Name: VCA0671 Funciton: hypothetical protein Locus tag: VSAL_I2465 Name: VCA0673 Funciton: Transcriptional regulator, LacI family
	VSAL_I2463		MFS transporter
	VSAL_I2464	VCA0671	hypothetical protein
	VSAL_I2465	VCA0673	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD