Regulon of VCA0673 in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VCA0673
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	VCA0673 - Vibrionales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -163 Score: 6.4 Sequence: AAATGGGTACGCATTCATTT Locus tag: VCA0669 Name: null Funciton: MFS transporter Locus tag: VCA0671 Name: VCA0671 Funciton: hypothetical protein
	VCA0669		MFS transporter
	VCA0671	VCA0671	hypothetical protein
Position: -195 Score: 6.4 Sequence: AAATGAATGCGTACCCATTT Locus tag: VCA0667 Name: null Funciton: sodium-solute symporter, putative Locus tag: VCA0666 Name: sds Funciton: L-serine dehydratase (EC 4.3.1.17)
	VCA0667		sodium-solute symporter, putative
	VCA0666	sds	L-serine dehydratase (EC 4.3.1.17)
Position: -43 Score: 5.2 Sequence: TGATGACTACGTAACTATTT Locus tag: VCA0673 Name: VCA0673 Funciton: Transcriptional regulator, LacI family
	VCA0673	VCA0673	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD