Regulon of VCA0673 in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_07064, VSAK1_07059
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	VCA0673 - Vibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.4 Sequence: TTATGCATACGTACCAATTT Locus tag: VSAK1_07064 Name: VCA0673 Funciton: Transcriptional regulator, LacI family Locus tag: VSAK1_07059 Name: VCA0673 Funciton: Transcriptional regulator, LacI family
	VSAK1_07064	VCA0673	Transcriptional regulator, LacI family
	VSAK1_07059	VCA0673	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD